Adaptive Biotechnologies Corporation · NASDAQ:ADPT
Adaptive Biotechnologies — William Blair Growth Stock Conference 2023
22 slides from Adaptive Biotechnologies's conference presentation, 2023
Slide 1: William Blair Growth Stock Conference 2023
William Blair Growth Stock Conference 2023
Slide 2: Safe Harbor
Safe Harbor This presentation has been prepared by Adaptive Biotechnologies Corporation (“we,” “us,” “our,” “Adaptive” or the “Company”) and is made for informational purposes only. The information set forth herein does not purport to be complete or to contain all relevant information. Statements co
Slide 3: Our Mission
Our Mission Translate the genetic language of the adaptive immune system into clinical products to diagnose and treat disease Immune Receptor data ◼ Founded in 2009 ◼ NASDAQ listed 2019 (ADPT) ◼ 790 employees ◼ 700+ publications to date 3 © Copyright Adaptive Biotechnologies 2021. Confidential.
Slide 4: Genetics Data
Using the immune system as the source-code for immune medicine Immune System Immune Medicine T Cells Autoimmune Cancer Genetics Data disorders B Cells Infectious Neurodegenerative diseases disorders 4
Slide 5: Business areas of focus: MRD and Immune Medicine
Business areas of focus MRD Immune Medicine (IM) Highly sensitive NGS-based assessment of MRD Rich immune receptor data informs clinical trials in heme for use in clinical practice and drug trials. and development of transformative medicines. TAM ~$5B* TAM ~$44B* Clinical Testing MRD Pharma Pharma S
Slide 6: Focused strategy on each business area with efficient capital allocation
Focused strategy on each business area with efficient capital allocation Focused strategy in Strong capital position two business areas to support growth ▪ MRD: increase clonoSEQ ▪ Disciplined investments penetration ▪ Opex reduction ▪ Immune Medicine: drive ▪ Over three years of cash on hand opport
Slide 7: MRD
MRD
Slide 8: Monitoring MRD in select blood cancers with our clonoSEQ Assay
Monitoring MRD in select blood cancers with our clonoSEQ Assay Unique DNA sequences are identified for all B or T* cells DNA sequences of VDJ region DNA sequences ATGCGGCGATGGTGTCGAGCGAGTGCTGCATGC GCTAGTGCGATGAGTGGAGCTAATCGAGCTTAG of VDJ region CAGGCTAGATGGATGCGCGATTAGCATTAGTAG Normal B or T* cells
Slide 9: clonoSEQ is the gold standard for MRD in heme malignancies
clonoSEQ is the gold standard for MRD in heme malignancies Deep ▪ Highest sensitivity – detects one in 1M cancer cells Pharma Sensitivity ▪ Only FDA approved MRD assay for ALL, MM and CLL* Use ▪ 150+ publications, 100+ ongoing studies FDA ▪ 260M+ covered lives Approved NCCN Guidelines ▪ NCCN guideli
Slide 10: We are in early innings of penetration with significant opportunity to grow
We are in early innings of penetration with significant opportunity to grow… MRD Business Revenue ($M)1 Used in ~5% of lymphoid cancer patients in US2 44% 19% 6% 5% 2% ALL MM CLL NHL 86% 81 Overall Pharma penetration of ~21%3 16% 56 51% 30 90% 84% 91% 26 49% 10% 16% 9% FY 2019 FY 2020 FY 2021 FY 202
Slide 11: Expanding clonoSEQ utilization in lymphoid cancer patients
Expanding clonoSEQ utilization in lymphoid cancer patients Three-pronged strategy to increase penetration while enhancing customer experience (EPIC integration), expanding coverage and increasing ASP Increase testing in blood Expand into NHL (DLBCL) Increase usage /patient ◼ 35% in blood as of Q1’23
Slide 12: Significant clonoSEQ abstracts at ASCO/EHA 2023
Significant clonoSEQ abstracts at ASCO/EHA 2023 ABSTRACT ABSTRACT ABSTRACTS 18 w/ clonoSEQ DATA Data Highlighting benefits of clonoSEQ ORAL ◼ 73% of patients that discontinued 5 PRESENTATIONS Multiple Myeloma therapy based on their MRD status (MASTER trial)1 remained free of therapy with sustained M
Slide 13: On track to achieve MRD key milestones for 2023
On track to achieve MRD key milestones for 2023 ◼ Increase penetration in community setting MRD ◼ Complete EMR (EPIC) integration ◼ Growth impact from DLBCL in 2H ◼ Filing with FDA for approval of DLBCL assay ◼ Read-out data for use in blood in MM ◼ Additional data on therapy discontinuation ◼ ASP i
Slide 14: Immune Medicine
Immune Medicine
Slide 15: Immune Medicine Platform Growth Areas
Immune Medicine Immune Medicine Platform Growth Areas Immune T cells Pharma Services Drug Discovery receptors Sequence Target Discovery Map Immune receptor T-cell Therapeutics Pair sequencing Characterize B cells Antibody Therapeutics Autoimmune Cancer Infectious Neurodegenerative disorders diseases
Slide 16: Immune receptor data fuels our pipeline in cancer and autoimmune disease
Immune receptor data fuels our pipeline in cancer and autoimmune disease Drug Discovery efforts to meet the High unmet clinical need… need ▪ Cell therapy in heme with early success Shared TCR ▪ Cell therapy in solid Cell Therapy Private tumors is the next frontier Cancer Novel Targets IBD, MS ▪ Effo
Slide 17: Good progress with GNE on two cell therapy programs
We are making good progress with GNE on two cell therapy programs TCRs targeting ✓ 1 TCR candidate selected to progress as a potential therapeutic product candidate • st shared cancer ✓ • Delivered 2 additional TCR data packages for Genentech consideration neoantigens ✓ We are focused on supporting
Slide 18: On track to achieve Immune Medicine key milestones for 2023
On track to achieve Immune Medicine key milestones for 2023 ◼ GNE collaboration Immune Medicine ❑ Speed to the clinic with lead shared product candidate ❑ Complete private product prototype; transition focus to IND-readiness ◼ Deliver key “go/no go” proof points in autoimmune disorders drug discover
Slide 19: FY 2023 guidance
FY 2023 guidance ◼ Revenue: 2023 full year revenue range $205M - $215M ❑ MRD and Immune Medicine revenue represents ~55% / 45% of total revenue at mid -point ❑ >50% clonoSEQ test volume growth vs FY 2022 ◼ FY 2023 operating expenses: ❑ Expect FY OPEX (including cost of revenue) below FY 2022 ◼ 2023
Slide 20: Strong Financial highlights
Strong Financial highlights Path to Profitability / Cash Flow breakeven Estimated 5 yrs P&L progression 1▪ Revenue CAGR from 2022-2027 to be 20-30% ($M) 2 ▪ 2019-2022 CAGR of 30% Revenu e Opex* $400 2▪ Adj EBITDA1 positive 2025 20-30% CAGR 1 ▪ Prudent spend management $200 3 CF $0 3▪ Cash Flow Break
Slide 21: Adaptive Biotechnologies Key Takeaways
Adaptive Biotechnologies Key Takeaways ✓ Gold standard MRD test in blood cancers with significant penetration ahead ✓ Differentiated capabilities to discover & develop immune receptors as therapeutics ✓ Well capitalized with clear path to profitability
Slide 22: Thank You.
Thank You.
Adaptive Biotechnologies — William Blair Growth Stock Conference 2023 on 6ix