Adaptive Biotechnologies Corporation · NASDAQ:ADPT
Adaptive Biotechnologies — Q1 2026 Earnings Presentation
31 slides from Adaptive Biotechnologies's earnings presentation, May 5, 2026
Slide 1: Investor Relations Corporate Presentation
Investor Relations Corporate Presentation
Slide 2: Safe Harbor
Safe Harbor This presentation has been prepared by Adaptive Biotechnologies Corporation (“we,” “us,” “our,” “Adaptive” or the “Company”) and is made for informational purposes only. The information set forth herein does not purport to be complete or to contain all relevant information. Statements co
Slide 3: Our Mission
Our Mission Translate the genetic language of the adaptive immune system into clinical products to diagnose and treat disease ◼ Founded in 2009 ◼ NASDAQ listed 2019 (ADPT) ◼ 630+ employees ◼ 700+ publications to date ◼ 430+ patents issued 3 © Adaptive Biotechnologies 2026. Confidential.
Slide 4: The immune system detects and treats most diseases in the same way
The immune system detects and treats most diseases in the same way Adaptive Immune System Cells Disease Cell Antigen T Cell B Cell T Cell Receptor Disease Signals (Antigens) Receptors bind to specific signals of disease 4 © Adaptive Biotechnologies 2026. Confidential.
Slide 5: Revealing its massively diverse genetic code may transform medicine
Revealing its massively diverse genetic code may transform medicine INDIVIDUAL POPULATION TRILLIONS MILLIONS OF TCRs OF ANTIGENS GGAGTGTAACTCGATGAGTT 30K >100M ACCCGCTAATCGAACTGGGC GAGAGATCCCAGCGCTGATG GENES GENES CACTCGATCCCGAGGCCTGA CCCGACATATCAGCTCAGAC HUM AN ADAPTIVE TAGAGCGGGGCTGTTGACGT GENOME
Slide 6: The adaptive immune system is our source-code for immune medicine
The adaptive immune system is our source-code for immune medicine IMMUNE SYSTEM APPLICATIONS Diagnostics (MRD) T Cells TCR-Antigen Data & GENETICS DATA Prediction Model to Inform Target/Drug Discovery B Cells AUTOIMMUNE CANCER DISORDERS 6 © Adaptive Biotechnologies 2026. Confidential.
Slide 7: Adaptive innovation timeline
Adaptive innovation timeline TCR Discovery Therapeutic TCRs Adaptive Adaptive partners Biotechnologies HQ Opening with Microsoft* Capabilities build Founded by Harlan and In Seattle, WA Adaptive IPO TCR Discovery HQ Relocation Pfizer To map the human immune Genentech TCR-Antigen Mapping to inform Ch
Slide 8: Two business segments: MRD and Immune Medicine
Two business segments: MRD and Immune Medicine Minimal Residual Disease (MRD) in Heme: Immune Medicine: Diagnostics Business Drug Discovery Business Gold standard Leaders in MRD test in TCR and antigen blood cancers mapping Pharma Services Data Clinical testing Biopharma trials TCR and BCR TCR-antig
Slide 9: Management team driving strategy
Management team driving strategy Talented and diverse management team with experience and skills to drive and execute strategy Kyle Piskel 9 © Adaptive Biotechnologies 2026. Confidential.
Slide 10: MRD
MRD A commercial stage diagnostics business
Slide 11: clonoSEQ is a measurable (or minimal) residual disease (MRD) test
clonoSEQ® is a measurable (or minimal) residual disease (MRD) test that can detect the number of cancer cells that can remain in a patient’s body during and after therapy, to inform treatment decisions throughout care. FDA-cleared in multiple myeloma, ALL and CLL; CLIA-validated in DLBCL, MCL, and o
Slide 12: Our MRD business provides value to all stakeholders
Our MRD business provides value to all stakeholders clonoSEQ MRD is transforming care for heme cancers “Using an FDA-cleared test that is available to “With more sensitive MRD testing…….we can clinicians and patients means that the detect way before any laboratory value, scan, or prognostic value of
Slide 13: clonoSEQ is the gold standard in hematology MRD
clonoSEQ® is the gold standard in hematology MRD Clinical Volumes Payer Coverage1 Guideline Clinical & Coverage ~45% Evidence 300M Covered lives today from CAGR 2021-2025 80M in 2020 Strong IP Most Sensitive Assay Pharma Studies Total Unique Patients3 ~180 Pharma FDA Cleared >100K Use >100 studies u
Slide 14: clonoSEQ captures the synergistic value of clinical diagnostics and pharma
clonoSEQ captures the synergistic value of clinical diagnostics and pharma Pharma supports lifecycle expansion which drives clinical use Clinical testing Pharma trials Monitor response to Accelerate drug treatment via development and serial quantification of Clinical usage drives commercialization b
Slide 15: clonoSEQ leverages the biology of B cells and T cells to count cancerous cells
clonoSEQ leverages the biology of B cells and T cells to count cancerous cells DNA sequences Healthy Malignant DNA sequences of VDJ region B or T cells B or T cells of VDJ region Unique dominant cancerous sequence(s) in each patient clonoSEQ identifies and quantifies specific cancer-associated seque
Slide 16: Disease burden assessment is integral to clinical decision-making
Disease burden assessment is integral to clinical decision-making throughout the treatment continuum Disease Phase Purpose • Stage disease Diagnosis • Evaluate patient prognosis • Assess treatment response Active Treatment • Intensify / de-intensify treatment • Determine need for additional treatmen
Slide 17: Other methods for clinical MRD evaluation in lymphoid cancers are limited
Other methods for clinical MRD evaluation in lymphoid cancers are limited Other traditional approaches to monitoring lymphoid cancers: ALL & CLL MM DLBCL1 MCL1 Flow cytometry Flow cytometry M-protein tests PET / CT scans PET / CT scans Serum FLC LIMITATIONS Variable Sensitivity • Low Specificity • L
Slide 18: How does clonoSEQ compare to MFC?
How does clonoSEQ compare to MFC? Percentage of patients who were MRD-negative by MFC but had residual disease by clonoSEQ What it means ADULT PED MM CLL ALL ALL Many [patients] with apparent ‘MRD- negativity’ by MFC still relapse. These 40-50% 79% 46% 39% relapses are likely due to residual leukemi
Slide 19: clonoSEQ is supported by a robust evidence base
clonoSEQ is supported by a robust evidence base with significant commitment to additional data generation “These findings raise questions about the “The presence of even very low levels of “Peripheral blood ctDNA assessments can role of first-line ASCT in the era of potent MRD (e.g., 10−4 to 10−6) c
Slide 20: In the U.S. payer coverage has extended to over 300M lives
In the U.S. payer coverage has extended to over 300M lives for MM and ALL, 200M lives in CLL and 70M lives in DLBCL Only FDA-cleared MRD assay available in the US Medicare coverage is available nationally for myeloma, ALL, CLL, DLBCL and MCL; recurrence monitoring for MCL Coverage policies establish
Slide 21: Clinical volume growth accelerating with penetration upside ahead
Clinical volume growth accelerating with penetration upside ahead clonoSEQ test volumes Sales force DLBCL EMR MCL MCL expansion launch integration launch recurrence monitoring 39% 35% 53% 51% ~106k 24k FY-21 FY-22 FY-23 FY-24 FY-25 ~US 31% 14% 11% 8% 3% penetration:2 CLL DLBCL ALL MM MCL 21 1 Heme-o
Slide 22: clonoSEQ is the test of choice for major drug developers in heme cancers
clonoSEQ is the test of choice for major drug developers in heme cancers Only FDA cleared MRD test in heme cancers and growing use as an endpoint Portfolio Overview Portfolio Mix by Indication ◼ 50 BioPharma partners ALL ◼ Sequencing revenue plus regulatory milestones 10% NHL/ ◼ Potential milestone
Slide 23: Key priorities to grow the MRD business while reaching profitability
Key priorities to grow the MRD business while reaching profitability Key Priorities Strategic Drivers Blood-based Guidelines Community EMR Data Increase testing presence integrations generation Penetration and Test Frequency Coverage expansion Production lab OPEX leverage / ASP increase efficiencies
Slide 24: Key MRD financial highlights
Key MRD financial highlights MRD revenue ($M) ~$212 Profitable business 15% $146 CAGR $103 Double-digit revenue growth $87 $66 53% CAGR Operating leverage Pharma Clinical FY-21 FY-22 FY-23 FY-24 FY-25 34% ~65% +Adj. EBITDA +Cash Flow ‘21-’25 revenue CAGR Sequencing GM1 ‘25 Achieved in Q2 ‘25 Achieve
Slide 25: Immune Medicine (IM)
Immune Medicine (IM) An immune-based data discovery business
Slide 26: TCR-antigen binding plays a key role in the immune response to disease
TCR-antigen binding plays a key role in the immune response to disease Challenge Solution Opportunity TCR-antigen binding Use our data to change how Connect cellular immune training data to many diseases are diagnosed response to disease model at scale and treated Billions Millions of TCR-antigen AI
Slide 27: We have generated large scale proprietary immune receptor data
We have generated large scale proprietary immune receptor data TCR-antigen TCR-antigen Solving TCR- data at scale AI model antigen binding challenge to >5M paired TCRs to antigen Sufficient data to train & better understand (vs 40k publicly available) build AI model disease T-cell receptor data Publ
Slide 28: Data monetization opportunities
Data monetization opportunities Potential Data Driven Offerings TCR-Antigen TCR-Antigen Target Discovery Training Data AI Prediction Model Partners to license a subset(s) Partners to use our model for specific Partners to use our capabilities to of our training data drug development use cases identi
Slide 29: Financials
Financials
Slide 30: Financial highlights
Financial highlights Revenue (in millions) $277M MRD Immune Medicine 65M2 ▪ FY 2026 MRD revenue $185M $179M guidance $255-$265 million $170M $154M ➢ Guidance only provided for MRD 33M1 business 98M 68M1 $98M 88M 212M ▪ ~$227 million in cash, cash 145M 66M equivalents and marketable 87M 87M securitie
Slide 31: FY 2026 guidance
FY 2026 guidance FY 2026 revenue guidance: ❑ MRD revenue between $255M-$265M → +22%1 Y/Y ; +30% Y/Y1 excl. milestones ➢ MRD milestones between $8M and $9M FY 2026 operating expenses guidance: ▪ OPEX between $350M-$360M → +6% Y/Y2 Achieve positive adjusted EBITDA and positive FCF for whole company by
Adaptive Biotechnologies — Q1 2026 Earnings Presentation on 6ix