10x Genomics, Inc. · NASDAQ:TXG
10x Genomics — Investor Day (December 2022)
138 slides from 10x Genomics's investor day presentation, Dec 8, 2022
Slide 1: Investor Day
Investor Day December 8, 2022
Slide 2: Welcome
Welcome Cassie Corneau Head of Investor Relations and Strategic Finance 2
Slide 3: Agenda
Agenda 9 am Mastering Biology to Advance Human Health Serge Saxonov, PhD, Chief Executive Officer & Co-Founder The 10x Innovation Engine Ben Hindson, PhD, Chief Scientific Officer & Co-Founder Products & Technology Michael Schnall-Levin, PhD, Chief Technology Officer & Founding Scientist Software Al
Slide 4: Forward-Looking Statements
Forward-Looking Statements Certain statements in this presentation and the accompanying oral commentary are “forward-looking statements” within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended, which are subject
Slide 5: Mastering Biology to Advance Human Health
Mastering Biology to Advance Human Health Serge Saxonov, PhD CEO & Co-Founder 5
Slide 6: Key Themes
Key Themes 10x is built with a long-term mission and ambition to take on biology’s 1 most important challenges and advance human health 2 Our innovation engine is a fundamental differentiator 3 We are in the very early stages of realizing massive market opportunities 4 10x is an established leader w
Slide 7: 10x Today
10x Today $500M+ 48% 4,250+ 5-year revenue Last 12-month revenue Instruments Sold CAGR 1,200+ 1,700+ 4,100+ Employees Patents / applications Publications Note: Last 12-month revenue, instruments sold, and publications as of September 30, 2022. Employees and patents and applications as of December 1,
Slide 8: 10x in 2013
10x in 2013 t-SNE2 8
Slide 9: Seed Fundraising: "How are you going to do it?"
Seed Fundraising: “How are you going to do it?” 9
Slide 10: Key Milestones
Key Milestones 2022 2021 Xenium Platform 2020 Chromium X launch Series launch 2019 Surpassed Visium 1,000 10x Cloud Next GEM CytAssist 2016 publications launch technology launch 2015 Chromium introduction Opened Platform First Singapore 2012 launch Visium commercial manufacturing Company Platform sa
Slide 11: Century of Biology
Century of Biology 11
Slide 12: Biology Is Immensely Complex
Biology Is Immensely Complex 40 trillion cells in the human body Each cell with its own set of expressed genes Enormous complexity within each cell Interactions of millions of different molecules and molecular machines Cells form tissues, which form organs Each tissue with a large diversity of cells
Slide 13: Mastering Biology Requires High Resolution and Massive Scale
Mastering Biology Requires High Resolution and Massive Scale Genomics-led path to understanding human biology Next phase Initial focus of Genomics Expand to address Focus on DNA all of biology ● Human Genome Project ● Downstream biological experiments ● Genome wide association studies ● Multiomics ●
Slide 14: Resolution and Scale to Resolve the Complexity of Biology
Resolution and Scale to Resolve the Complexity of Biology Conventional gene expression Single cell data for millions of cells t-SNE2 t-SNE2 t-SNE2 t-SNE1 t-SNE1 © 10X GENOMICS, INC. 2022 14
Slide 15: Deep Expertise Across Diverse Disciplines
Deep Expertise Across Diverse Disciplines Hardware Biology Chemistry Data Software © 10X GENOMICS, INC. 2022 15
Slide 16: Innovation Engine
Innovation Engine 25+ Breakthrough products 1,700+ Patents and applications $1B+ Invested in R&D to date 2022 2021 Xenium Platform 2020 Chromium X Visium CytAssist 2019 Series Chromium 2018 Connect Single Cell Gene Next GEM 10x Cloud Expression Flex 2017 Epigenetics Multiome Visium FFPE 2016 Visium
Slide 17: Proven Capability to Drive Early-Stage Acquisitions from Concept to Commercialization
Proven Capability to Drive Early-Stage Acquisitions from Concept to Commercialization 2018 2018 2020 2021 ATAC & Multiome Visium Platform Xenium Platform BEAM 2018 2019 2022 2022 © 10X GENOMICS, INC. 2022 17
Slide 18: Three Platforms to Resolve Biology's Complexity
Three Platforms to Resolve Biology’s Complexity Chromium Single Cell Visium Spatial Xenium In Situ t-SNE2 18
Slide 19: Chromium Single Cell Platform
Chromium Single Cell Platform Market-Defining Platform ● Catalyzed Single Cell revolution ● Broad menu of assays, analytes and applications ● High performance, quality of data and ease of use ● 4,150+ instruments sold ● Extensive ecosystem of customers, data sets, protocols and papers 2015 2018 2019
Slide 20: Visium Spatial Platform
Visium Spatial Platform The Leader in Spatial Discovery ● The only platform for unbiased spatial analysis ● Bridges worlds of histology and genomics ● Used in thousands of customer labs ● 365+ publications and pre-prints ● 2x customer datasets than all other methods $40M 2020 2020 Spatially Resolved
Slide 21: Xenium In Situ Analysis Platform
Xenium In Situ Analysis Platform Built to be the In Situ Spatial Biology Leader ● Highly sensitive and specific ● Class-leading speed and throughput ● Customizable, biologically relevant content panels ● Compatible with standard pathology, including H&E ● Easy-to-run workflow with intuitive analysis
Slide 22: We Develop Products to Provide the Deepest Biological Insights
We Develop Products to Provide the Deepest Biological Insights Chromium Visium Xenium 22
Slide 23: We Fuel Discoveries Across Life Sciences
We Fuel Discoveries Across Life Sciences 4,100+ © 10X GENOMICS, INC. 2022 23
Slide 24: All Tissues Are Heterogeneous and Complex
All Tissues Are Heterogeneous and Complex t-SNE2 © 10X GENOMICS, INC. 2022 24
Slide 25: 10x Products Are Transforming Our Understanding of Disease
10x Products Are Transforming Our Understanding of Disease Cancer Autoimmune Neuroscience Other fields >100 diseases © 10X GENOMICS, INC. 2022 25
Slide 26: Replacing the Legacy Toolkit Across Life Sciences
Replacing the Legacy Toolkit Across Life Sciences Resolution- spatial & cellular insights IF & ISH Flow cytometry IHC High High content imaging & cell based assays PCR/qPCR Low ELISAs Western Bulk Next Gen blots Sequencing Low High Scale of measurements - plexy, number of analytes © 10X GENOMICS, IN
Slide 27: Large Opportunity in Life Sciences Research
Large Opportunity in Life Sciences Research Global life science research $65B Life sciences research tools market tools spend $67B $16B $16B Tools where 10x Genomics offers More of this total opportunity is ultimately Applications where 10x natural alternatives addressable as researchers adopt large
Slide 28: Expanding Opportunities Beyond Research Tools
Expanding Opportunities Beyond Research Tools Global life science research tools spend $67B $16B $10B Tools where 10x Genomics offers More of this total opportunity is ultimately Downstream clinical natural alternatives addressable as researchers adopt large applications scale, high-resolution metho
Slide 29: Revolutionizing How Researchers Address Biological Questions
Revolutionizing How Researchers Address Biological Questions $5B $7B $2B $2B Cellular & $16B Genetic molecular Atlassing Translational mechanisms biology Identify cellular & Determine role of Understand functions of Apply biological molecular building genetics in biological specific gene, protein or
Slide 30: Market Growth Drivers
10x technology innovation to drive adoption by 1 delivering better insights, workflows and cost structure Expansion of single cell approaches into more areas 2 of academic research Market Adoption of single cell in translational and Growth 3 biopharma applications Drivers Emergence of spatial biolog
Slide 31: Broad Commercial Reach
Broad Commercial Reach ~460 Commercial employees 170+ Commissionable salesforce 150+ Field and technical support specialists 35 Authorized distributors Note: Commercial employee statistics and authorized distributors as of December 1, 2022. © 10X GENOMICS, INC. 2022 31
Slide 32: Virtuous Cycle of Innovation
Virtuous Cycle of Innovation Customer Deep customer success relationships Superior economics Differentiated products in important markets Innovation Amazing Exciting talent technologies & powerful mission © 10X GENOMICS, INC. 2022 32
Slide 33: Innovation Engine: Products and Technology
Innovation Engine: Products and Technology Ben Hindson Chief Scientific Officer & Co-Founder Michael Schnall-Levin Chief Technology Officer & Founding Scientist 33
Slide 34: We Develop Products to Provide the Deepest Biological Insights
We Develop Products to Provide the Deepest Biological Insights Chromium Visium Xenium 34
Slide 35: We Have Built a World-Class Product Development Engine
We Have Built a World-Class Product Development Engine Fast iteration cycles, Quality, supply Head-start on key needs broad set of solutions to robustness, cost structure, and future directions challenges fast iteration cycles © 10X GENOMICS, INC. 2022 35
Slide 36: 10x's Platforms Are Highly Synergistic
10x’s Platforms Are Highly Synergistic Shared Shared Shared Technology Workflows Software 36
Slide 37: Chromium, Visium, Xenium on Matched FFPE Samples
Chromium, Visium, Xenium on Matched FFPE Samples FFPE tissue dissociation Serial FFPE sections 10K cells target Single Cell Gene Expression Flex Visium Spatial Xenium In Situ Whole transcriptome In Situ gene expression © 10X GENOMICS, INC. 2022 37
Slide 38: Chromium Single Cell
Chromium Single Cell 38
Slide 39: Chromium Platform – Product Releases Powered by Innovation
Chromium Platform – Product Releases Powered by Innovation Chromium Single Cell Platform © 10X GENOMICS, INC. 2022 39
Slide 40: Chromium Single Cell Platform
Chromium Single Cell Platform ● Small to Large Scale Studies ● Many Supported Sample Types ● Multiomics 40
Slide 41: Multiple Assays Provide New Views Into Cell Type, State and Function
Multiple Assays Provide New Views Into Cell Type, State and Function Functional Genomics Gene Expression Immune Cell Profiling 5’ CRISPR 3’, 5’, Flex 5’ + VDJ + BEAM Cellular Proteins Epigenomics Accessible Chromatin Multiplexed Antibody scATAC-seq Panels Multiome © 10X GENOMICS, INC. 2022 41
Slide 42: Chromium – Impact
Chromium – Impact Cumulative Publications Biological Impact 3,800+ publications Customer Innovation © 10X GENOMICS, INC. 2022 42
Slide 43: Recent Product Additions
Chromium Recent Product Additions Nuclei Isolation Kit Barcode Enabled Gene Expression Flex Antigen Mapping (BEAM) Shipping Now 43
Slide 44: Barcode Enabled Antigen Mapping (BEAM)
Barcode Enabled Antigen Mapping (BEAM) Discover Antigen-Specific BCRs and TCRs 3 Profile whole BEAM-Ab Antibody Discovery transcriptome 1 gene expression Antigen + Feature Barcode Identify antigen oligo + specificity fluorophore (PE) BCR BEAM-T Cancer Immunotherapy Peptide-MHC + 2 4 Feature Barcode
Slide 45: Gene Expression Flex: The New Gold Standard
Gene Expression Flex: The New Gold Standard Scale up with Multiplexing Superior Sensitivity: 2-3x More Genes Streamlined FFPE Sample Prep Protocols 128 samples, 1m cells per run New - Auto New - Manual Flex Old 3’ v3.1 FFPE Compatibility Reduced Sequencing Cost 2 year old Breast Cancer Fix, Batch, R
Slide 46: Early Customer Success Demonstrating the Power of Flex
Early Customer Success Demonstrating the Power of Flex Superior Performance Access to FFPE Fred Hutch, Evan Nevell Luciano Martelotto, University of Adelaide © 10X GENOMICS, INC. 2022 46
Slide 47: Single Cell Gene Expression Flex: Data Demonstration
Single Cell Gene Expression Flex: Data Demonstration 32 different lung cancer samples, on one chip ● 32 clinical samples clustered by donor ● 1 Chromium chip ● 1 week processing ● ~1 million single cells ● 50% less sequencing © 10X GENOMICS, INC. 2022 47
Slide 48: Key Development Directions
Key Development Directions Sample breadth and Cell and sample scaling Additional analytes and flexibility multiomics ● Fixation compatibility with ● Toward all-in $0.01 / cell ● Single cell isoform analysis a wider range of analytes and beyond ● Customizable content - snvs, ● End-to-end solutions ●
Slide 49: Visium Spatial
Visium Spatial created with https://gganimate.com/ 49
Slide 50: Visium Platform – On Market Products
Visium Platform – On Market Products Visium Spatial Platform © 10X GENOMICS, INC. 2022 50
Slide 51: Visium – Impact
Visium – Impact Cumulative Visium Publications & Preprints Biological Impact 365+ publications & preprints Customer Innovation © 10X GENOMICS, INC. 2022 51
Slide 52: Recent and Upcoming Product Additions
Visium Platform Recent and Upcoming Product Additions Visium CytAssist Visium FFPE v2 Visium Gene and Protein on CytAssist Expression on CytAssist Expected 1H 2023 52
Slide 53: FFPE v2 on CytAssist: Key Improvements
FFPE v2 on CytAssist: Key Improvements Human Brain: v2 (CytAssist) vs v1 (Direct Placement) ● Improved tissue retention ● Optimized human probe set ● Sharper spatial resolution ● Improved gene sensitivity and specificity ● Access to archival samples © 10X GENOMICS, INC. 2022 53
Slide 54: CytAssist Is the Future of Visium
CytAssist Is the Future of Visium Expanding CytAssist Capabilities Fresh Frozen Samples Mouse Lung Replicates Highest Quality Data Streamlined Logistics GeX + Protein Multiomics T cells (CD3E) Broadest Sample Access Protein RNA Efficient hardware, robust reagents and powerful analysis tools drive sp
Slide 55: Key Development Directions
Visium Platform Key Development Directions Resolution Tissue and Additional Analytes Sample Scaling and Multiomics 55
Slide 56: Xenium: Available Now
Xenium: Available Now Highly sensitive and specific Customizable, biologically relevant content Industry leading speed and throughput Easy to run workflow with intuitive analysis software Best-in-class service and support Highly extensible platform
Slide 57: Imaging and Molecular Analysis Have Been Separate Worlds
Imaging and Molecular Analysis Have Been Separate Worlds
Slide 58: Xenium Is Built on Powerful Foundations
Xenium Is Built on Powerful Foundations 280+ Enabling Patents Key Technological Advances Talent and Expertise Acquired technologies have been used in over 70 customer studies and 15 customer pre-prints and publications to date © 10X GENOMICS, INC. 2022 58
Slide 59: Xenium Chemistry – Flexible and Powerful
Xenium Chemistry – Flexible and Powerful Powerful Architecture High Sensitivity High Specificity Negative DNA Negative probe counts decoding counts 0.1% <0.01% 54+ M transcripts detected ● Minimal gene length requirements and tunable detection for high expressors ● Future: go beyond expression: isof
Slide 60: Xenium Is Compatible with a Broad Range of FFPE Tissues
Xenium Is Compatible with a Broad Range of FFPE Tissues Brain - cancer Breast - cancer Lung - normal Skin - cancer 1mm 1mm 1mm 1mm Colon - normal Pancreas - normal Kidney - normal Lymph node - normal 1mm 1mm 1mm 1mm 60
Slide 61: Data Driven and Curated Approach to Panel Design
Data Driven and Curated Approach to Panel Design Chromium and Visium data ● Fit-for-purpose panels ● Validated ● Require no optimization Scientific literature Expert Feedback +100 Custom Genes on Every Run © 10X GENOMICS, INC. 2022 61
Slide 62: Class-Leading Throughput with Large Imageable Area
Class-Leading Throughput with Large Imageable Area Throughput mm2/week Vessel embedded in invasive tumor. Yellow, endothelial markers. Red, tumor markers ~21.5 mm Other Other Xenium commercial commercial platform 1 platform 2 Vessel with T-cells adjacent invasive tumor domain. T-cell markers, FFPE h
Slide 63: Xenium Leaves Tissue Morphology Intact and Is Compatible with Standard Pathology Workflows
Xenium Leaves Tissue Morphology Intact and Is Compatible with Standard Pathology Workflows Compatibility Post Xenium H&E staining IF staining Visium via CytAssist © 10X GENOMICS, INC. 2022 63
Slide 64: Single Cell & Spatial: A Use Case In Cancer Biology
Single Cell & Spatial: A Use Case In Cancer Biology ● Cancer is highly heterogeneous: What’s going on, where? ● The most relevant samples are frequently FFPE ● This preprint shows how comprehensive Single Cell and Spatial Omics technologies can transform our understanding of tumorigenesis and cancer
Slide 65: Exploring Breast Cancer Biology
Exploring Breast Cancer Biology 10K cells target FFPE tissue Serial FFPE dissociation sections Single Cell Gene Expression Flex Visium Spatial Xenium In Situ Whole transcriptome In Situ gene expression © 10X GENOMICS, INC. 2022 65
Slide 66: Single Cell FFPE Reveals Molecularly Distinct Cancer-Associated Cells
Single Cell FFPE Reveals Molecularly Distinct Cancer-Associated Cells Key metrics ● 30,365 cells ● 91% reads in cells Per cell: ● 10,450 median reads ● 1,480 median genes ● 2,191 median UMIs © 10X GENOMICS, INC. 2022 66
Slide 67: Visium Reveals the Localization of Molecularly Distinct Cancer-Associated Cells
Visium Reveals the Localization of Molecularly Distinct Cancer-Associated Cells Gene markers for specific cell types pre-CytAssist H&E Visium Spatial Plot © 10X GENOMICS, INC. 2022 67
Slide 68: Xenium Localizes Cell Subtypes on Breast Cancer FFPE Sample
Xenium Localizes Cell Subtypes on Breast Cancer FFPE Sample Xenium Cell Annotations Selection of Regions of Interest © 10X GENOMICS, INC. 2022 68
Slide 69: Visium and Xenium Integration Derive Differentially Expressed Genes in a Triple-Positive ROI
Visium and Xenium Integration Derive Differentially Expressed Genes in a Triple-Positive ROI © 10X GENOMICS, INC. 2022 69
Slide 70: Visium and Xenium Integration Derive Differentially Expressed Genes in a Triple-Positive ROI
Visium and Xenium Integration Derive Differentially Expressed Genes in a Triple-Positive ROI © 10X GENOMICS, INC. 2022 70
Slide 71: We Develop Products to Provide the Deepest Biological Insights
We Develop Products to Provide the Deepest Biological Insights Chromium Visium Xenium 71
Slide 72: Innovation Engine: Software
Innovation Engine: Software Alex Wong SVP, Product, Software and Infrastructure 72
Slide 73: Software as an accelerant
Software as an accelerant …for our customers …as well as ourselves 73
Slide 74: @HD @SQ VN:1.0
@HD VN:1.0 SO:coordinate @SQ SN:1 LN:249250621 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:1b22b98cdeb4a9304cb5d48026a85128 @SQ SN:2 LN:243199373 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:a0d9851da00400dec1098a9255ac712e @SQ SN:3 LN:198022430 AS:NCBI37 UR:file:/
Slide 75: Quality of Software Is Critical to Velocity of Research
Quality of Software Is Critical to Velocity of Research ● Harvard study found that 74% of R files included in scientific publications and datasets (all fields) simply failed to execute ● High-quality, reliable software is essential to accelerating research: ○ Our internal research & development ○ Ou
Slide 76: Software Bridges the Last Mile
Software Bridges the Last Mile Analysis/Visualization Software Single Cell and Spatial Modalities Molecular Assays Core Detection © 10X GENOMICS, INC. 2022 76
Slide 77: New Data Types, at New Scales, Require New Software
New Data Types, at New Scales, Require New Software Entirely New Data Types At Entirely New Scales © 10X GENOMICS, INC. 2022 77
Slide 78: Accelerating Our Customers
Accelerating Our Customers ● Removes barriers to adoption ● Expands the user base ● Accelerates utilization ● Increases scale of usage ● Great experience builds loyalty © 10X GENOMICS, INC. 2022 78
Slide 79: "I generally tell people that 10x is the first company in the NGS space…"
“I generally tell people that 10x is the first company in the NGS space … that has a true end-to-end product. I often highlight the streamlined software as major plus in the 10x platform and why we have continued to pump samples through 10x.” – Core Lab Director © 10X GENOMICS, INC. 2022 79
Slide 80: Software Across the Full Workflow
Software Across the Full Workflow @-AACFGCCFF9EFCEECFFGG,CEGF< @M00308:166:000000000-C4CVY:1:1102:9851:1489 3:N:0:0 CTGGCAGAATAATCTGCTTCCATCCCGCCAGTTTGGTTTCATTGTACTGACAACCTCAGCTGGCCTCATGGACCATGATGAATCAAGCCGA + -84,C,4D8EF8;EEFE<B@FFFF8<:+@F+6C,C:EFCGGGGGE@F9FACFGCEFGGG<FFGD,CFC6<6CC6:EF9,,<,,<,,:,:8
Slide 81: Core Analysis
Core Analysis @-AACFGCCFF9EFCEECFFGG,CEGF< @M00308:166:000000000-C4CVY:1:1102:9851:1489 3:N:0:0 CTGGCAGAATAATCTGCTTCCATCCCGCCAGTTTGGTTTCATTGTACTGACAACCTCAGCTGGCCTCATGGACCATGATGAATCAAGCCGA + -84,C,4D8EF8;EEFE<B@FFFF8<:+@F+6C,C:EFCGGGGGE@F9FACFGCEFGGG<FFGD,CFC6<6CC6:EF9,,<,,<,,:,:8+ @M00308:166:000000
Slide 82: Scaling Across a Diversity of Customer Environments
Scaling Across a Diversity of Customer Environments Standalone Local Systems Institutional HPC Clusters Public and Private Clouds © 10X GENOMICS, INC. 2022 82
Slide 83: Software for Our Full Range of Applications and Use Cases
Software for Our Full Range of Applications and Use Cases Single Cell Spatial Gene Expression Gene Expression 14 Distinct software products Immune Profiling Proteogenomics CRISPR Screening In Situ 60+ Major software Epigenetics releases Gene Expression Multiomic ATAC + GEX Proteomics Multiomic Cytom
Slide 84: Extended Analysis and Visualization
Extended Analysis and Visualization 84
Slide 85: Expanding the Ecosystem
Expanding the Ecosystem De Facto Standards Academic and Research Third Party Tools for Data Formats Methods and Tools scverse / scanpy satijalab / seurat cole-trapnell-lab / monocle-release © 10X GENOMICS, INC. 2022 85
Slide 86: Xenium On-Board Analysis
Xenium On-Board Analysis ● Primary and secondary analysis on-board ● Egress data directly from instrument to local network and compute ● Cloud not required for instrument to run, but will be available for optional storage, re-analysis and collaboration, giving customers more flexibility 86
Slide 87: Genes (313)
Genes (313) Tumor General (9) Tumor DCIS (4) Tumor Invasive (1) Proliferative (2) Myoqithelial Subtype 1 (5) # ACTA2 Myoepithelial Subtype 2 (4) Stroma (6) c<vvvyve
Slide 88: Acceleration from Our Approach to Software
Acceleration from Our Approach to Software Accelerating Customers Accelerating 10x ● Removes barriers to adoption ● Increases R&D iteration speed ● Accelerates utilization ● Aligns us with customer needs ● Increases scale of usage ● Enhances service and supportability ● Expands the user base ● Revea
Slide 89: R&D Infrastructure
R&D Infrastructure 5+ Core-Millennia PBs R&D Data Generated “The machine that builds the machine” – a focus on of CPU Time and Managed iteration speed in overall product development 100M’s 500k+ Compute Jobs Executed Samples Analyzed © 10X GENOMICS, INC. 2022 89
Slide 90: 10x Cloud Platform
10x Cloud Platform ● Best available experience for core analysis pipelines ● 5x faster than a typical run ● Platform for connected instruments ● Hub for end-to-end Xenium experience, visualization and future third-party integrations ● Strong, consistent growth in usage © 10X GENOMICS, INC. 2022 90
Slide 91: Software as an accelerant
Software as an accelerant …for our customers …as well as ourselves 91
Slide 92: Innovation Engine: Intellectual Property
Innovation Engine: Intellectual Property Eric Whitaker Chief Legal Officer 92
Slide 93: Broad Patent Portfolio Covering Foundational Technologies
Broad Patent Portfolio Covering Foundational Technologies Total Issued or Allowed: Total Pending: 694 (266 US 428 Foreign) 1,038 (579 US 459 Foreign) Note: Patent data as of December 1, 2022. © 10X GENOMICS, INC. 2022 93
Slide 94: Patent Coverage Highlights: Chromium
Patent Coverage Highlights: Chromium Platform technologies ● Barcodes and UMIs for tracking the molecular and cellular origins of an analyte ● Multiple single cell techniques such as droplet, microwell, and split-pool Assays ● Multiomic assays, including Feature Barcoding for probing single cell pro
Slide 95: Patent Coverage Highlights: Visium
Patent Coverage Highlights: Visium Platform technologies ● Spatial arrays and barcoding methods for high throughput spatial readouts ● Photolithography fabrication techniques for high density spatial arrays ● Formation and decoding of random spatial arrays Assays ● Fresh frozen (RT) and FFPE (RTL) s
Slide 96: Patent Coverage Highlights: Xenium
Patent Coverage Highlights: Xenium Platform technologies ● Temporal barcoding and detection of biological molecules in situ, a critical paradigm used in high- plexy FISH and in situ sequencing applications ● 3D matrix embedding and clearing of extraneous molecules for improved in situ signal ● Criti
Slide 97: Velocity of Patent Portfolio Fuels Innovation Engine
Velocity of Patent Portfolio Fuels Innovation Engine Issued or Allowed Patents Cumulative Patent Applications Filed New applications filed Note: Patent data as of December 1, 2022. 97
Slide 98: Customer Perspective
Customer Perspective Sam Behjati, PhD Group Leader and Wellcome Senior Research Fellow, Wellcome Sanger Institute Moderated by: Abbey Cutchin Associate Director, Market Development, Oncology 98
Slide 99: Q&A
Q&A Serge Saxonov Ben Hindson Michael Schnall-Levin Alex Wong Eric Whitaker 99
Slide 100: Customer Perspective
Customer Perspective Shyam Prabhakar, PhD Associate Director, Spatial & Single Cell Systems, Genome Institute of Singapore Moderated by: Abbey Cutchin Associate Director, Market Development, Oncology 100
Slide 101: Talent and Culture
Talent and Culture Rebecca Port, Ph.D. Chief People Officer 101
Slide 102: The 10x Magic
The 10x Magic 1 We are mission driven and stay relentlessly focused on that mission 2 We believe exceptional talent delivers outsized results 3 We put we before me 4 We operate from first principles 5 We strive for exponential impact © 10X GENOMICS, INC. 2022 102
Slide 103: Accelerate the mastery of biology to advance human health
Accelerate the mastery of biology to advance human health 103
Slide 104: Exceptional Talent Delivers Outsized Results
Exceptional Talent Delivers Outsized Results 115% 37,000+ 3-year headcount growth Applicants over the last G&A 12 months 13% 76% Of leaders with public scaling experience Commercial R&D 330+ 47% 35% 36% Ph.D.s Women in workforce ● Scaled team, ready to solve hard problems ● Rigorous recruitment proc
Slide 105: What We Hire For
What We Hire For Intellectual Drive and Collaboration horsepower passion 105
Slide 106: We Before Me
We Before Me 87% 93% Employees feel like Employees say they work they belong at 10x with amazing colleagues Mutual Respect Empathy Humility Note: Statistics based on company employee survey data. © 10X GENOMICS, INC. 2022 106
Slide 107: We Operate from First Principles / We Strive for Exponential Impact
We Operate from First Principles We Strive for Exponential Impact ● We think, plan and act based on first ● We have unbridled ambition principles ● Innovation is core to what we do ● Forge our own path ● Ideas with exponential impact create ● Do not accept convention more value than the rest ● Drive
Slide 108: Continuing the Magic
Continuing the Magic 1 We are mission driven and stay relentlessly focused on that mission 2 We believe exceptional talent delivers outsized results 3 We put we before me 4 We operate from first principles 5 We strive for exponential impact © 10X GENOMICS, INC. 2022 108
Slide 109: Commercial Engine
Commercial Engine Jim Wilbur Chief Commercial Officer 109
Slide 110: Key Messages
Key Messages We have a strong commercial organization with global reach and capacity, scaled by the explosive growth of the single cell revolution We are optimizing our commercial operations and culture for the next stage of growth Our current markets and products have tremendous potential We are im
Slide 111: Broad Reach, High-Impact Commercial team
Broad Reach, High-Impact Commercial team ~460 24 170+ 150+ 35 Commercial Countries with Commissioned Field & Technical Authorized Employees Employees Sales Professionals Support Specialists Distributors Industry Leadership Widespread Adoption Customer Success TOP TOP 1M+ >50 100 20 4,100+ 100 of the
Slide 112: World-Class Service and Support
World-Class Service and Support “10x always strives to develop “Best in class single cell products.” products that can address the needs Large Pharma “I love how 10x Genomics combines of a wide range of customers, thereby the hardware, reagent and software to advancing and empowering their provide a
Slide 113: Evolution for the Next Stage of Growth
Evolution for the Next Stage of Growth 113
Slide 114: Creating a Unified Commercial Culture
Creating a Unified Commercial Culture Sales Marketing Support Marketing complex products is Helping others succeed is Sales is a profession, not a hustle about solving problems the greatest joy Science of human behavior Good marketing is not easy Sales are great, partnerships are better Process, tra
Slide 115: Optimizing for Performance and Efficiency
Optimizing for Performance and Efficiency Provide a common language to drive customer success Process Training Systems & Tools ● Sales Campaigns ● Opportunity Management ● CRM Environment ● KOL Engagement ● Prospecting ● Analytics & Reporting ● Efficiency Metrics ● Negotiation ● Forecasting © 10X GE
Slide 116: Maximizing the Tremendous Opportunity Ahead
Maximizing the Tremendous Opportunity Ahead Drive more routine use with Bring a broader base of researchers existing customers into the 10x ecosystem 1 Accelerating adoption 2 Removing bottlenecks with best-in-class technologies 3 Delivering superior commercial execution © 10X GENOMICS, INC. 2022 11
Slide 117: Accelerating Adoption
1 Accelerating Adoption Key technology development directions to open broad and routine use Better workflow & sample prep More accessible pricing Better insights & data analysis Key enablers of adoption Customer awareness and education curve Growing funding for single cell & spatial 50+ ~2.5x 35% 74
Slide 118: Removing Bottlenecks with Best-in-Class Technologies
2 Removing Bottlenecks with Best-in-Class Technologies Chromium X Single Cell Gene Visium Series Expression Flex CytAssist ● ● Easy access to tissues Higher throughput ● Superior performance ● ● Flexible workflow Access to Flex assay ● FFPE compatible ● Improved performance ● Batched processing Abou
Slide 119: Removing Bottlenecks: Pharma Opportunity
2 Removing Bottlenecks: Pharma Opportunity 170+ peer-reviewed publications ~20% of revenue Novel target identification Biomarker discovery Response tracking Antibody discovery Cell response to therapies Patient stratification Cell therapy characterization Mechanism of action of therapy Biomarker cor
Slide 120: Delivering Superior Commercial Execution
3 Delivering Superior Commercial Execution Cross-Functional Teams E-Commerce Inside Sales Expansion ● Single cell & spatial ● Increased access ● Efficient sales growth ● Multiple applications ● Order configuration ● Dedicated prospecting ● Instruments & consumables ● Dynamic pricing ● Account manage
Slide 121: Leveraging Commercial Scale to Power Xenium Launch
Leveraging Commercial Scale to Power Xenium Launch Create best customer experience Deploy full global team for Xenium Leverage scale, relationships and experience Augment with dedicated specialists Grow field service and support functions Adapt through close integration with R&D © 10X GENOMICS, INC.
Slide 122: Unlocking the Full Potential of 10x
Unlocking the Full Potential of 10x Three Integrated Platforms • Advanced Capabilities • Scaled Commercial Organization 122
Slide 123: Operational Scale
Operational Scale Ben Hindson Chief Scientific Officer and Co-Founder 123
Slide 124: Manufacturing and Distribution Scale
Manufacturing and Distribution Scale Global Operations Team 200+ employees Scalable Operations ● Manufacturing facilities in California and Singapore ● Distribution centers in US, APAC, EU and UK Company-wide Partnership ● New products development partnered with R&D ● Operational efficiency partnere
Slide 125: Built for Scale: Network Capacity Built for Growth Multiples
Built for Scale: Network Capacity Built for Growth Multiples Pleasanton, California Singapore USA, Europe, APAC 150k+ sq ft 50k+ sq ft Manufacturing Partners ● New product introduction ● Reagent production ● Instrument systems, ● Manufacturing systems ● Formulation & kitting components & modules ● P
Slide 126: Embedded Teams Accelerate Innovation and Execution
Embedded Teams Accelerate Innovation and Execution Pleasanton, California Singapore Design & Test Automate Develop & optimize & scale New product initiatives On-market products © 10X GENOMICS, INC. 2022 126
Slide 127: Delivering a Best-in-Class Financial Profile
Delivering a Best-in-Class Financial Profile Justin McAnear Chief Financial Officer 127
Slide 128: Reporting Updates
Reporting Updates Implementing with 2023 financial periods reporting Annual Total Revenue ● Total of instruments, consumables and service Guidance Instruments ● Instruments revenue by Chromium / Spatial ● Consumables revenue by Chromium / Spatial Consumables ● Total service revenue for all product l
Slide 129: High Revenue Growth Rate at High Margin
High Revenue Growth Rate at High Margin From $27M to >$500M expected annual revenue in 6 years 48% 5-Yr CAGR 28% 3-Yr CAGR Note: Revenue growth CAGR assumes midpoint of 2022 guidance of $510.0 million. © 10X GENOMICS, INC. 2022 129
Slide 130: Recent Revenue Metrics
Recent Revenue Metrics Last Twelve-Month Revenue 85% recurring Geographic Growing % of spatial revenue diversification revenue Note: Last twelve-month revenue as of September 30, 2022. Single cell and spatial revenue split excludes services revenue. © 10X GENOMICS, INC. 2022 130
Slide 131: Visium Is the Leading Spatial Discovery Platform
Visium Is the Leading Spatial Discovery Platform Cumulative Visium Publications & Preprints Cumulative Spatial Revenue ($M) 365+ $75M+ publications & cumulative revenue preprints © 10X GENOMICS, INC. 2022 131
Slide 132: Invested for Scale
Invested for Scale Additional investments in headcount and infrastructure will reduce in 2023 Annual Operating Expenses and Capital Expenditures ($M) Minimal headcount increase in 2023 >50% CapEx reduction in 2023 SG&A Headcount 312 427 647 ~690 R&D Headcount 223 336 464 ~465 Note: 2022E based on ac
Slide 133: Levers for Becoming Free Cash Flow Positive
Levers for Becoming Free Cash Flow Positive ● Expansion of existing customer usage / new customer acquisitions / new products Revenue ● First full year of Xenium, CytAssist, Flex, BEAM, and others ● Preserve gross margins on existing product lines Gross Margin (Xenium instruments lower margin with m
Slide 134: Delivering a Best-in-Class Financial Profile
Delivering a Best-in-Class Financial Profile 1 High revenue growth rate at high gross margins fuels our innovation engine Our currently poised for leverage Commercial and R&D 2 teams expand at a lower rate than our revenue growth, with significantly lower near-term CapEx investments Focus on achievi
Slide 135: Q&A
Q&A Serge Saxonov Ben Hindson Justin McAnear Jim Wilbur Rebecca Port 135
Slide 136: Closing Remarks
Closing Remarks Serge Saxonov, PhD CEO & Co-Founder 136
Slide 137: Key Themes
Key Themes 10x is built with a long-term mission and ambition to take on biology’s 1 most important challenges and advance human health 2 Our innovation engine is a fundamental differentiator 3 We are in the very early stages of realizing massive market opportunities 4 10x is an established leader w
Slide 138: Investor Day
Investor Day December 8, 2022