Slide 1: Genetic Technologies Limited: a commercially successful Australian biotechnology leader
genetic technologies LIMITED a commercially successful Australian biotechnology leader Presentation May 2003
Slide 2: Who is GTG?
who is GTG? ¢ Owner of unique, patent protected intellectual property covering non- coding DNA ¢ Operator of a fee-for service DNA testing laboratory in Australia ¢ Developer of other biotechnology ventures including RareCellect, ImmunAid and PGGP
Slide 3: The people
Fred Bart, Deputy Chairman 25 years in the textiles industry Prof. Deon Venter, Head of Cancer Susceptibility Testing A specialist in the genetics of cancer Murdoch Children’s Research Institute and University of Melbourne lan Dennis, Executive Director Chartered Accountant, formerly with KPMG Dr Ma
Slide 4: What is non-coding DNA?
what is non-coding DNA? ACATGCCCTCCAGAGTTTTATAGGGCATATAATCTGTAACAGATGAGAGGAAGCCAATIG CCCTTTAGAAATATGGCTGTGATTGCCTCACTICCTGTGTCATGTGACGCTCCTAGTCAT CACATGACCCATCCACATCGGGAAGCCGGAATTACTIGCAGGGCTA ACCTAGTGCCTA’ GCTAAGGCAGGTACCTGCATCCTIGTITITGTTIAGTGGATCCTCTATCCTICAGAGACT CTGGAACCCCTGTGGTCTTCTCTICATCTAAT
Slide 5: Non-coding DNA isn't junk
non-coding DNA isn't junk ...It is essential tn: ¢ typing organs for transplant purposes; * settling disputed paternity; |° forensics; and ' « testing for genetically susceptibility * to diseases such as breast cancer. ...not to mention Non-coding DNA is essential to understanding coding DNA, as ind
Slide 6: GTG's IP position in non-coding DNA is solid
GTG’s IP position in non-coding DNA is solid via ownership of two broad groups of patents: ¢ Intron Sequence Analysis Method for Detection of Adjacent and Remote Locus Alleles as Haplotypes (U.S. patents 5,192,659, 5,612,179 and 5,789,568) ...covers use of non-coding DNA when examining DNA to perfor
Slide 7: Potential, infringing and secured licensees
* genomics companies * owners of proprietary genes * genetic testing firms * pharmaceutical companies + developers of gene * bioinformatics companies diagnostic devices * genetic researchers number of potential licensees: 1 May 03 - 1783 (AGM Nov 02 - 879) number of infringing licensees: 1 May 03 -
Slide 8: GTG is implementing a successful commercialisation strategy
—_ GTG is implementing a J successful commercialisation strategy for non-coding DNA ¢ patent insurance — * regular contact with * U.S.-based legal potential licensees team ° license fee rising « database of with each deal potential licensees Blakely Sokoloff Taylor’/\ / Zalman A Limited Liability Pa
Slide 9: The cost of a license increased throughout 2002 and into 2003
_the cost of a license increased F throughout 2002 and into 2003 Value of deal (A$m} 5.0 | 40 3.0 | 2.0 | 1.0 + 0.0 Genetic Solutions Nanogen (April Sequenom (April Perlegen Myriad Genetics Pyrosequencing (February 2002} 2002) 2002) Sciences (October 2002} (March 2003) (September 2002) total deal va
Slide 10: The October 2002 deal with Myriad Genetics was a landmark
Myriad owns patents over the BRCA1 and BRCA2. When mutated, these genes raise susceptibility to breast cancer from 10% to between 35% and 80% Myriad paid GTG a US$1m upfront license fee to use GTG’s non-coding DNA IP Myriad will pay GTG an ongoing annual license fee , the October 2002 deal with ' My
Slide 11: The March 2003 deal with Pyrosequencing AB
° q ° 1) A$0.8m license fee, plus 2) A$2.2m in royalties on reagent sales to 2015 expands the life of GTG’s revenue from the deal, plus » the March 2003 deal with F Pyrosequencing AB leveraged various aspects of GTG’s business to create shareholder value 3) three analytical instruments worth A$0.7m
Slide 12: April 2003 deal with ARUP opened up genetic testing laboratories
an April 2003 deal with ARUP opened up a programme license genetic testing laboratories Associated Regional and University Pathologists, owned by the University of Utah, paid US$75,000 for a non-coding DNA license there are between 100 and 200 major genetic testing labs similar to ARUP in the U.S. a
Slide 13: Patent life is favourable to GTG
j patent life is favourable to GTG ¢ intron sequence analysis: U.S. until _ 2010, Europe until 2013 -f * genomic mapping: U.S. until 2015, Europe until 2016 ¢ all licensees to date have required both patents.
Slide 14: GTG is a leader in fee for service DNA testing
GTG is a leader in fee for service DNA testing 2002 revenue was $1.6m, but grew 20% on 2001 GTG is the largest disputed paternity DNA lab in Australia The Myriad cancer susceptibility tests indicate strong growth for the business looking forward The lab is moving on a number of growth options, inclu
Slide 15: Revenue from the testing business has been growing
» gp revenue from the testing _ business has been growing DNA testing revenue (A$m) 1.80 1.60 + 1.40 + 1.20 + 1.00 - 0.80 5 0.60 ~ 0.40 5 0.20 | 0.00 1998 1999 2000 2001 2002
Slide 16: RareCellect will seek to improve genetic testing of the unborn
RareCellect® will seek to improve genetic testing of the unborn ¢ based on granted patents (see U.s.patents 5,153,117 and 5,447,842) ¢ safer than amniocentesis and chorionic villus biopsy * potentially deepens the market by being less expensive than these procedures * now being commercialised
Slide 17: GTG has invested in various other promising ventures
» GTG has invested in various ' other promising ventures ¢ PGGP - doing genomics work on parasites such as cryptosporidium at the University of Melbourne © ImmunAld (GTG 60%) developing a potential AIDS treatment at the University of Western Australia that was initially devised by a GTG consulting s
Slide 18: GTG's financial position is solid
GTG's financial position is solid * debt: g$om * Low burn rate: net operating cash outflow for the year to Mar 2003 of $7. 04m * First positive quarter in December 2002: net operating cash inflow of $0. 5m - cash (as at 31/3/2003): 67. 3M
Slide 19: Creating shareholder value
‘creating shareholder value * projections based on our licensing success to date indicates strong value emerging for GTG shareholders ¢ strong upside from master possible license arrangement can enhance this value creation process
Slide 20: The stock
the stock ¢ Listed shares: 261.5m * Unlisted options (exercise price 20 cents to 61 cents, expiry 4/2005 and 11/2007): 80.7m * Total diluted shares: 80.7 * Top 20 shareholders: approx: 68% * Listed on ASX since August 2000 (ASX Code GTG) as well as OTC on Nasdaq (GNTLF) since 2002. All time high 93
Slide 21: GTG has been making a social investment
GTG has been making a social investment ...by sponsorship of efforts to save from extinction the brush- tailed rock wallaby
Slide 22: Disclaimer
www.gtg.com.au Disclaimer: This document has been prepared by the management of Genetic Technologies Limited for the benefit of brokers, analysts and institutional investors and not as specific advice to any particular party or person. The information is based on publicly available information, inte