Qiagen N.v. · NYSE:QGEN
Qiagen — Shareholder Meeting (June 2016)
66 slides from Qiagen's shareholder meeting presentation, Jun 21, 2016
Slide 1: 2015 Annual General Meeting
2015 Annual General Meeting June 21, 2016 Venlo, the Netherlands Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 1
Slide 2: Agenda
Agenda 1 Dr. Werner Brandt Opening Chairman of the Supervisory Board Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 2
Slide 3: Agenda
Agenda 2 Managing Board Report for the year ended December 31, 2015 (“Calendar Year 2015”) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 3
Slide 4: 2015 Annual General Meeting – Peer M. Schatz, CEO
2015 Annual General Meeting June 21, 2016 Venlo, the Netherlands Peer M. Schatz Chief Executive Officer Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 4
Slide 5: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 6: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG BUILDING BLOCKS OF LIFE AACAAGTTAA
Slide 7: Customers want molecular insights
Customers want molecular insights Faster Better More efficiently The opportunity: Address demands for differentiated molecular testing solutions Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 7
Slide 8: QIAGEN at a glance
QIAGEN at a glance 2015 sales ~$1.3 billion Customers >500,000 Global reach >35 countries Employees ~4,600 Share listings NASDAQ / Frankfurt Headquarters Netherlands We help customers gain insights to improve healthcare and advance science Sample to Insight QIAGEN Annual General Meeting, June 21, 20
Slide 9: World leader in molecular testing solutions
SAMPLE TO INSIGHT SOLUTIONS Sample Technologies Assay Technologies Bioinformatics Automation Systems VALUABLE BIOLOGICAL MOLECULAR SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 9
Slide 10: QIAGEN sales by product group
QIAGEN sales by product group As % of 2015 net sales: $1.3 billion Consumables and Molecular Diagnostics related revenues ~50% of sales (incl. bioinformatics) ~87% Applied Testing Pharma Life Sciences ~50% of sales ~13% Academia Instruments and automation solutions Addressing the needs of >500,000 c
Slide 11: QIAGEN sales by customer class
QIAGEN sales by customer class As % of annual net sales $1.3 bn $1.3 bn $1.2 bn 23% 22% Academia $1.0 bn Life 26% Sciences 26% 19% 20% Pharma 20% 8% 9% Applied Testing 21% 3% 7% 10% U.S. HPV 6% 15% 22% Molecular 46% Rest of portfolio Diagnostics 40% 32% 25% 2009 2011 2013 2015 MDx portfolio Applied
Slide 12: Technologies and applications
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other PCR Technologies NGS Assay QuantiFERON Other Software and Biox biological content TB / Immune Infectious Human ID / Pharma Life
Slide 13: Following a clear strategic development plan
1984 – 2000 2000 – 2004 2004 – 2013 >2014 COMPONENTS AUTOMATION WORKFLOWS SAMPLE TO INSIGHT SOLUTIONS Offer individual Automate individual Develop integrated Create hyper-connected technologies workflow steps automated workflows and high-utility solutions with full test menu Following a clear strate
Slide 14: Transforming QIAGEN to leadership
Adjusted net sales overview: 2011-2015 Annual sales growth In $ billions, as percentage of sales Constant exchange rate (CER) growth rates $1.4 bn 14% 13% 1.4 $1.3 bn $1.3 bn $1.3 bn 1.2 $1.2 bn 12% 11% $1.1 bn ~25% ~30% ~22% ~33% ~18% 10% 1.0 ~15% 9% 8% 10% 7% 0.8 6% 8% 6% 0.6 6% ~68% ~67% ~65% ~65
Slide 15: Leveraging the potential of QIAGEN's portfolio
Sample Technologies QuantiFERON-TB QIAsymphony Personalized Healthcare (PHC) GeneReader NGS System QIAseq universal solutions Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 15
Slide 16: Sample Technologies: Most trusted brand
Sample Technologies: Most trusted brand QIAGEN: #1 in Sample Technologies 2015 key achievements Addition of MO BIO for microbiome samples Expansion of leadership in liquid biopsy Automation solutions on QIAsymphony Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 16
Slide 17: QuantiFERON-TB Gold
QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis Latent TB testing total addressable market: $1 bn 2015 key achievements Successful commercialization of 4th generation QuantiFERON-TB in Europe Delivering more than 7 million tests in 2015 Record sales in 2015 of $115 million
Slide 18: QIAsymphony: Driving molecular testing dissemination
QIAsymphony: Driving molecular testing dissemination 2016 target: >1,750 installed systems 2015 key achievements Achievement of 2015 target of >1,500 cumulative placements CE-IVD marked multiplex assay in Europe for detection of respiratory tract infections Sample to Insight QIAGEN Annual Genera
Slide 19: Personalized Healthcare
Personalized Healthcare: Pioneer in companion diagnostics More than 15 master collaboration agreements 2015 key achievements More than 15 master collaboration agreements with leading pharma companies First CE-IVD liquid biopsy CDx for Iressa in lung cancer Broadening indications beyond cancer
Slide 20: NGS: Driving dissemination into routine clinical use
NGS: Driving dissemination into routine clinical use ~80% of all NGS runs conducted on samples processed with QIAGEN 2015 key achievements Launch of the GeneReader NGS System: First complete Sample to Insight solution Extending portfolio of QIAseq solutions for any sequencer Global expansion o
Slide 21: Bioinformatics: Best in-class data analysis
Bioinformatics: Best in-class data analysis and interpretation Expected output of NGS data in 2015: 1.5 billion DVDs 2015 key achievements Launch of QIAGEN Clinical Insight (QCI) as decision support tool Launch of new CLC Microbial Workbench for microbiome/metagenomics Launch of hereditary dis
Slide 22: 2016: Moving ahead with our transformation
2016: Moving ahead with our transformation 2016 ambitions Moving beyond significant U.S. HPV pressure Above-market growth from rest of portfolio Investing to accelerate growth drivers Targeted geographic expansion Value-creating acquisitions Sample to Insight QIAGEN Annual General Meeting,
Slide 23: Sustainability update
Sustainability update Green development Economic progress Corporate citizenship ~ 725 tons of CO2 saved Recognized as one of Promoting integration of in 2015 Germany’s “Top Employers” Syrian refugees ~925 tons of waste Aiding largest-ever forensics materials recycled in 2015 project in Vie
Slide 24: Success factor: Employees
Success factor: Employees Creating a vibrant workforce Selected HR programs Providing ideal working conditions Talent development for succession planning Advancing personal development Performance-oriented compensation Creating a strong corporate culture Healthy work-life balance service
Slide 25: Corporate governance
Corporate governance About QIAGEN N.V. Endorsing relevant principles Organized under the laws of Netherlands Application of Dutch governance standards Listed on NASDAQ (New York) NASDAQ – Corporate Governance Rules Member of TecDAX Index (Frankfurt) Sample to Insight QIAGEN Annual General
Slide 26: Investor Relations
Investor Relations Analyst ratings (As of June 2016) 2016 IR activities 17 Private shareholder day: ~30 participants Institutional conferences: ~20 events 1x1 investor meetings: ~500 meetings 9 Recognition through international IR awards 4 Buy Neutral Sell Sample to Insight QIAGEN Annual Gen
Slide 27: 2015: QIAGEN shares (Frankfurt)
2015: QIAGEN shares (Frankfurt) QIAGEN share price development – Frankfurt Stock Exchange (euros) QIAGEN (Frankfurt) TecDAX (Xetra) Year-end: € 25.12 40% +34% 30% +30% 20% 10% 0% -10% -20% Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2015 Sample to Insight QIAGEN Annual General Meeting, June 21,
Slide 28: 2015: QIAGEN shares (NASDAQ)
2015: QIAGEN shares (NASDAQ) QIAGEN share price development – NASDAQ (U.S. dollars) QIAGEN (NASDAQ) NASDAQ Biotech Index Year-end: $27.65 30% 25% +18% 20% 15% 10% +8% 5% 0% -5% -10% Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2015 Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 28
Slide 29: 2016 YTD: QIAGEN share performance (Frankfurt)
2016 YTD: QIAGEN share performance (Frankfurt) 2016 YTD share price performance vs. indices (As of June 17, 2016, euros) QIAGEN TecDAX 10% 5% 0% -5% -10% - -14% -15% -20% -25% - 27% -30% Jan Feb Mar Apr May Jun 2016 Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 29
Slide 30: 2016 YTD: QIAGEN share performance (NASDAQ)
2016 YTD: QIAGEN share performance (NASDAQ) 2016 YTD share price performance vs. indices (As of June 17, 2016, U.S. dollars) QIAGEN NASDAQ Biotech Index 0% -5% -10% -15% -20% - 24% -25% -25% -30% Jan Feb Mar Apr May Jun 2016 Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 30
Slide 31: 2006–2016: QIAGEN share performance (Frankfurt)
2006 – 2016: QIAGEN share performance (Frankfurt) Share price performance vs. indices (As of June 17, 2016) QIAGEN DAX 140% 120% 100% 76% 77% 80% 60% 37% 34% 40% 26% 17% 20% 0% -20% -10% -12% -14% -27% -40% YTD 1 year 3 years 5 years 10 years Sample to Insight QIAGEN Annual General Meeting, June 21,
Slide 32: 2006–2016: QIAGEN share performance (NASDAQ)
2006 – 2016: QIAGEN share performance (NASDAQ) Share price performance vs. indices (As of June 17, 2016) QIAGEN NASDAQ 140% 127% 120% 100% 83% 80% 60% 56% 39% 40% 20% 6% 8% 0% -4% -5% -20% -15% -25% -40% YTD 1 year 3 years 5 years 10 years Sample to Insight QIAGEN Annual General Meeting, June 21, 20
Slide 33: 2006–2016: QIAGEN share performance (NASDAQ)
2006 – 2016: QIAGEN share performance (NASDAQ) Share price performance vs. indices (As of June 17, 2016) QIAGEN S&P 500 140% 120% 100% 80% 67% 63% 60% 56% 40% 26% 20% 6% 8% 1% 0% -1% -20% -15% -25% -40% YTD 1 year 3 years 5 years 10 years Sample to Insight QIAGEN Annual General Meeting, June 21, 201
Slide 34: Summary
Summary Expanding leadership in Sample to Insight solutions Strong positions in the most exciting areas of molecular diagnostics and life sciences Setting course toward 2020 to accelerate growth and further innovation Commitment to maximizing value and improve returns Sample to Insight QIAGEN Annual
Slide 35: 2015 Annual General Meeting – Roland Sackers, CFO
2015 Annual General Meeting June 21, 2016 Venlo, the Netherlands Roland Sackers Chief Financial Officer Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 35
Slide 36: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 37: 2015: Overview (U.S. GAAP adjusted)
2015: Overview (U.S. GAAP adjusted) In $ millions Change (Except EPS) 2015 2014 $ (CER) 1 Solid overall performance in 2015 Adjusted 1,281.2 1,346.2 -5% 6% CER sales growth excluding U.S. HPV net sales(1) (+3% CER) Adjusted EPS $1.13 CER ($1.05 actual rates) Adjusted operating income 314.5 312.5
Slide 38: 2015: Adjusted net sales and EPS
2015: Adjusted net sales and EPS 2015 adjusted net sales development 2015 adjusted diluted EPS development (In $ billions) (In $ per share) +$0.13 $1.13 CER CER -$0.08 +3% CER $1.05 $1.35 bn -5% $1.00 $1.28 bn -3 p.p. +6% CER -8% p.p. ~3% ~97% of sales of sales 2014 2015 2015 2015 FX 2015 2014 2015
Slide 39: 2015: Adjusted net sales by customer classes
2015: Adjusted net sales by customer classes FY 2015 adjusted net sales: $1,281.2 million Consumables and related revenues +3% CER / ~87% of sales Instruments +5% CER / ~13% of sales MDx portfolio excl. HPV +7% CER +1% CER ~46% of sales Molecular Diagnostics ~49% of sales U.S. HPV -43% CER ~3% of sa
Slide 40: 2015: Geographic regions and product portfolio
2015: Geographic regions and product portfolio Full-year 2015 geographic region sales Full-year 2015 product portfolio sales Consumables and Europe / Middle East / Africa related revenues +6% CER +3% CER ~32% of sales ~87% of sales Instruments +5% CER Asia-Pacific / Japan ~13% of sales +7% CER Ameri
Slide 41: 2015: Key results (U.S. GAAP adjusted)
2015: Key results (U.S. GAAP adjusted) In $ millions (Unless indicated) 2015 2014 Change Adjusted net sales 1,281.2 1,346.2 -5% Adjusted gross profit 912.0 954.9 -4% Adjusted gross profit margin 71% 71% Adjusted operating income 314.5 312.5 1% Adjusted operating income margin 25% 23% Adjusted tax ra
Slide 42: 2015: Reconciliation of reported to adjusted results
2015: Reconciliation of reported to adjusted results (U.S. GAAP) In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 1,281.0 826.4 175.7 132.5 -5.6 4% 127.1 0.54 Adjustments Business integration 0.3 1.1 15.1 15.
Slide 43: 2015: Review of U.S. GAAP and IFRS results
2015: Review of U.S. GAAP and IFRS results Consolidated Income Statements for the year ended December 31, 2015 Difference In $ thousands U.S. GAAP IFRS (U.S. GAAP (Except per share data) 2015 2015 vs. IFRS) Net sales 1,280,986 1,280,986 Gross profit 826,375 819,260 7,115 R&D -147,180 -126,961 -20,21
Slide 44: 2015: Review of U.S. GAAP and IFRS results
2015: Review of U.S. GAAP and IFRS results Consolidated Income Statements for the year ended December 31, 2015 U.S. GAAP to IFRS reconciliation 2015 net income (In $ millions) 9 10 -12 1 -3 121 134 132 124 127 131 132 2015 Share-based Intangibles Revaluation Redemption of Other 2015 U.S. GAAP compen
Slide 45: 2015: Balance sheet and cash flow
2015: Balance sheet and cash flow (U.S. GAAP) As of December 31 2015 2014 Leverage ratio: Net debt / EBITDA1 Group liquidity (In $ millions) 421 577 3.5 3.3 Net debt (In $ millions) 642 601 3.0 Shareholder equity ratio 61% 60% 2.5 Net debt / adjusted EBITDA ratio(1) 1.6x 1.3x 2.2 2.0 1.6 1.5 1.3 Cas
Slide 46: 2015: Ongoing commitment to disciplined capital allocation
2015: Ongoing commitment to disciplined capital allocation DISCIPLINED CAPITAL ALLOCATION Reinvest for organic growth Increase returns Targeted M&A / licensing Strengthen our premium > $500 m returned to Continuing our strategy Sample to Insight portfolio shareholders (2013-2015) Novel techn
Slide 47: 2015: Prudent financing structure offers strategic flexibility
2015: Prudent financing structure offers strategic flexibility Structure as of December 31, 2015 Maturities of current main debt instruments (In $ millions) 600 Cash and short-term 2019 Notes investments 500 $421 m 73 400 2021 Notes 300 Net debt $642 m 200 430 300 300 U.S. Private Placement 100 27 0
Slide 48: Employees as of December 31, 2015
Employees as of December 31, 2015 Europe / Total Total Asia Pacific / Americas Middle East / Change Japan / ROW Q4 2015 Q4 2014 Africa Production 268 626 106 1,000 940 6% R&D 235 685 99 1,019 951 7% Sales 622 634 506 1,762 1,688 4% Marketing 79 164 71 314 309 2% Admin 106 294 64 464 451 3% Total 1,3
Slide 49: Summary
Summary 2015: Solid progress on initiatives to accelerate growth Growth drivers at forefront of QIAGEN transformation Commitment to returns and disciplined capital deployment Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 49
Slide 50: Agenda
Agenda 3 a. Supervisory Board Report on the Company’s Annual Accounts (the “Annual Accounts”) for Calendar Year 2015 b. Report of the Compensation Committee of the Supervisory Board for Calendar Year 2015 Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 50
Slide 51: Agenda
Agenda 4 Adoption of the Annual Accounts for Calendar Year 2015 (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 51
Slide 52: Reservation and dividend policy
Agenda 5 Reservation and dividend policy Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 52
Slide 53: Agenda
Agenda 6 Discharge from liability of the Managing Directors for the performance of their duties during Calendar Year 2015 (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 53
Slide 54: Agenda
Agenda 7 Discharge from liability of the Supervisory Directors for the performance of their duties during Calendar Year 2015 (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 54
Slide 55: Agenda
Agenda 8 Resolution to amend the Company’s Articles of Association (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 55
Slide 56: New appointment to Supervisory Board
New appointment to Supervisory Board Prof. Dr. Ross L. Levine, M.D. New member of Supervisory Board Physician-Scientist at Memorial-Sloan Kettering Cancer Center (New York) Professor of Medicine, Weill Cornell Medical College Director of MSKCC Center for Hematologic Malignancies and Laurence Josep
Slide 57: QIAGEN Supervisory Board – Intended structure
QIAGEN Supervisory Board – Intended structure Prof. Dr. Manfred Karobath Proposed Chairman of Supervisory Board Nomination Committee Chair Stéphane Bancel Dr. Metin Colpan Supervisory Director Supervisory Director Science and Technology Committee Chair Prof. Dr. Ross L. Levine Prof. Dr. Elaine Mardi
Slide 58: Agenda
Agenda 9 (Re-) Appointment of Mr. Stéphane Bancel Dr. Metin Colpan Prof. Dr. Manfred Karobath Prof. Dr. Ross L. Levine Prof. Dr. Elaine Mardis Mr. Lawrence A. Rosen Ms. Elizabeth E. Tallett as Supervisory Directors of the Company for a one year term ending at the close of the Annual General Meeting
Slide 59: Agenda
Agenda 10 Reappointment of Mr. Peer M. Schatz Mr. Roland Sackers as Managing Directors of the Company for a term ending on the date of the Annual General Meeting in 2017 (voting items) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 59
Slide 60: Agenda
Agenda 11 Reappointment of KPMG Accountants N.V. as auditors of the Company for the calendar year ending December 31, 2016 (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 60
Slide 61: Agenda
Agenda 12 Authorization of the Supervisory Board, until December 21, 2017 to: a. issue a number of Common Shares and financing preference shares and grant rights to subscribe for such shares, the aggregate par value of which shall be equal to the aggregate par value of all shares issued and outstand
Slide 62: Agenda
Agenda 13 Authorization of the Managing Board, until December 21, 2017, to acquire shares in the Company’s own share capital (voting item) Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 62
Slide 63: Questions
Agenda 14 Questions Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 63
Slide 64: Closing
Agenda 15 Closing Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 64
Slide 65: Thank you
Thank you Sample to Insight QIAGEN Annual General Meeting, June 21, 2016 65
Slide 66: QIAGEN Private Investor Day
QIAGEN Private Investor Day Wir möchten Sie herzlich zu unserem QIAGEN Private Investor Day 2016 am 23. September, 2016 von ca. 11:00 – 16:00 bei QIAGEN in Hilden, Deutschland einladen Kontakt: Alexandra König +49 2103 29 11709 E-Mail: alexandra.koenig@qiagen.com Sample to Insight QIAGEN Annual Gene