Bruker — Nasdaq 2024 London Investor Conference

4 slides from Bruker's conference presentation, Dec 4, 2024

Slide 1: Bruker Corporation at a Glance
NASDAQ INVESTOR CONFERENCE Bruker Corporation at a Glance ▪ Leading provider of high-value life science tools and solutions ~$3.2B (1) >11,000 R&D ~10% ▪ #1 or #2 market position in majority of our portfolio Revenue Colleagues of Revenue ▪ Deep expertise in physics, chemistry, and post-genomic biolo
Slide 2: A Transformation Story – Built for the Future
NASDAQ INVESTOR CONFERENCE A Transformation Story – BUILT FOR THE FUTURE Successful Strategy, Strength from Recent M&A: Poised for Rapid EPS Growth Pivot to Higher Growth, Higher Value Opportunities Operational Excellence ▪ Repositioned Bruker for high-growth, Project Accelerate Initiatives Discipli
Slide 3: Emerging Leadership in the Post-Genomics Era
NASDAQ INVESTOR CONFERENCE Emerging Leadership in the Post-Genomics Era Genomic Era Linear Sequences Multiomics in the Post-Genomic Era Single-Cell & Spatial Biology Proteins, PTMs & Proteoforms Structures, Function & Interactome ATGACTAGCTTGAGCT ACTAGGCATAGTTAACGTGA • Plasma proteomics TCGCTCAATGTT
Slide 4: US / China: Deep Dive
NASDAQ INVESTOR CONFERENCE US / China: Deep Dive US Insights China Insights o US represents ~28% of Bruker global revenues* Revenue by Geography* o China represents ~15% (normalized) of Bruker global revenues* o ACA/GOV end market reflects academic, gov’t research, medical research institutions/hosp