Alnylam Pharmaceuticals, Inc. · NASDAQ:ALNY
Alnylam Pharmaceuticals — Investor Presentation (September 2015)
38 slides from Alnylam Pharmaceuticals's investor presentation, September 2015
Slide 1: Corporate Overview
Corporate Overview September 2015 1
Slide 2: Alnylam Forward Looking Statements
Alnylam Forward Looking Statements This presentation contains forward-looking statements, within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Exchange Act of 1934. There are a number of important factors that could cause actual results to differ material
Slide 3: RNAi Therapeutics: A New Class of Innovative Medicines
RNAi Therapeutics A New Class of Innovative Medicines • Harness natural pathway ◦ Catalytic mechanism ◦ Mediated by small interfering RNA or “siRNA” • Therapeutic gene silencing ◦ Any gene in genome ◦ Distinct mechanism of action vs. other drug classes ◦ Unique opportunities for innovative medicines
Slide 4: RNAi Delivery to Liver Solved
RNAi Delivery to Liver Solved IV and SC Platforms (NHP) Enables advancement of innovative medicines to patients • Liver target gene silencing with lipid nanoparticle (LNP) technology and IV dosing • Advancement of proprietary conjugate platform for clinical translation and SC dosing ◦ Initial conjug
Slide 5: Alnylam RNAi Therapeutics Strategy
Alnylam RNAi Therapeutics Strategy A Reproducible and Modular Path for Innovative Medicines 2. POC achieved in Phase 1 ACAAGAUGCCAUUGUCCCCCGGCCUCC • Blood-based biomarker with strong UGCUGCUGCUGCUCUCCGGGGCCACGG disease correlation CCACCGCUGCCCUGCCCCUGGAGGGUG GCCCCUGGAGGG GCCCCACCGGCCGAGACAGCGAGCAUA
Slide 6: Alnylam Strategic Therapeutic Areas (STAr)
Alnylam Strategic Therapeutic Areas (STAr) Genetic Medicines Cardio-Metabolic Disease Hepatic Infectious Disease • Genetically validated • Genetically validated liver • Liver pathogen and/or liver targets for rare targets for dyslipidemia, host targets orphan diseases NASH, type 2 diabetes, • Sub-ac
Slide 7: Alnylam Development Pipeline
WLAlnylam. Development Pipeline GENETIC MEDICINES TTR-Mediated Amyloidosis Hemophilia and Rare Bleeding Disorders Complement-Mediated Diseases Hepatic Porphyrias Alpha-1 Antitrypsin Deficiency Primary Hyperoxaluria Type 1 TTR-Mediated Amyloidosis Beta-Thalassemia/|ron-Overload Disorders Additional G
Slide 8: Alnylam Development Pipeline: Genetic Medicines
WLAlnylam. Development Pipeline GENETIC MEDICINES TTR-Mediated Amyloidosis Hemophilia and Rare Bleeding Disorders Complement-Mediated Diseases Hepatic Porphyrias Alpha-1 Antitrypsin Deficiency Primary Hyperoxaluria Type 1 TTR-Mediated Amyloidosis Beta-Thalassemia/|ron-Overload Disorders Additional G
Slide 9: Transthyretin-Mediated Amyloidosis (ATTR) Program
GENETIC MEDICINES Transthyretin-Mediated Amyloidosis (ATTR) Program Unmet Need and Product Opportunity Progressive, debilitating monogenic disease • ATTR is significant orphan disease ◦ ~50,000 Patients worldwide • Clinical pathology ◦ Onset ~40 to >60 yr; fatal within 2-15 years ◦ Two predominant f
Slide 10: RNAi Therapeutics for ATTR Amyloidosis
GENETIC MEDICINES RNAi Therapeutics for ATTR Amyloidosis Patisiran and Revusiran Patisiran for Familial Amyloidotic Revusiran for Familial Amyloidotic Polyneuropathy (FAP) Cardiomyopathy (FAC) • Intravenous administration • Subcutaneous administration ◦ STC “first generation” chemistry • Positive Ph
Slide 11: Patisiran Phase 2 OLE Preliminary Study Results
GENETIC MEDICINES Patisiran Phase 2 OLE Preliminary Study Results* Change in mNIS+7 at 12 Months Evidence that neuropathy progression potentially halted at 12 months • Mean decrease of 2.5 points observed • Compares favorably with 13 to 18 point increase estimated from historical data sets • Similar
Slide 12: Patisiran Phase 2 OLE: Comparison Across FAP Studies
GENETIC MEDICINES Patisiran Phase 2 OLE Preliminary Study Results* Comparison of ΔNIS and ΔmNIS+7 Across FAP Studies Natural Natural Patisiran Tafamidis Diflunisal History History Phase 2 Fx1A-201§ Phase 3+ (linear)~ (nonlinear)# OLE† Mean (SEM) Prestudy: 17.3 (3.5) PBO: 12.6 (4.0) 12 Months NA 17.8
Slide 13: APOLLO Phase 3 Study Design
GENETIC MEDICINES APOLLO Phase 3 Study Design Primary Endpoint • mNIS+7 at 18 months Patient Population • FAP: any Patisiran IV infusion Secondary Endpoints 2:1 RANDOMIZATION TTR mutation, q3W, 0.3 mg/kg • Norfolk QOL-DN Stages 1 and 2 • NIS-weakness • mBMI • 10-meter walk test • Neurological • COMP
Slide 14: Revusiran Phase 2 Study Results
GENETIC MEDICINES Revusiran Phase 2 Study Results Open label, multi-dose study in TTR cardiac amyloidosis patients • Includes patients with FAC and senile systemic amyloidosis (SSA) • Up to 98.2% TTR knockdown with similar effects toward WT and mutant protein • Generally well tolerated ◦ Transient m
Slide 15: ENDEAVOUR Phase 3 Study Design
GENETIC MEDICINES APOLLO Phase 3 Study Design Patient Population • Documented TTR Co-Primary Endpoints mutation, including Revusiran 500mg SC • Change in 6-MWD at 2:1 RANDOMIZATION V122I or other qD x 5, then qW 18 months compared for 18 mos to baseline • Amyloid deposits • Percent reduction in on b
Slide 16: Hemophilia and Rare Bleeding Disorders Program
GENETIC MEDICINES Hemophilia and Rare Bleeding Disorders Program Unmet Need and Product Opportunity High unmet needs in hemophilia and rare bleeding disorders (RBD) • Hemophilias are recessive X-linked monogenic bleeding disorders ◦ Hemophilia A: loss of function in Factor VIII – >40,000 Patients in
Slide 17: Antithrombin and ALN-AT3 Program
GENETIC MEDICINES Antithrombin and ALN-AT3 Program Intrinsic system Extrinsic system Antithrombin (AT) is genetically Hemophilia B defined target FX FVIIa FVII FIX FIX FIXa • AT is key natural anticoagulant ◦ Inactivates Factor Xa and thrombin Hemophilia A ◦ Attenuates thrombin generation FVIII FVII
Slide 18: ALN-AT3 Interim Phase 1 Study Results
GENETIC MEDICINES ALN-AT3 Interim Phase 1 Study Results Potent, dose-dependent, and durable AT knockdown at low microgram/kilogram (mcg/kg) SC doses • Up to 86% AT knockdown and mean maximum AT knockdown of 59 ± 7% (p<0.05); durable, lasting ~60 days Evidence for potential re-balancing of hemostasis
Slide 19: ALN-AT3 Exploratory Post Hoc Analysis of Bleeding
GENETIC MEDICINES ALN-AT3 Interim Phase 1 Study Results Exploratory Post Hoc Analysis of Bleeding Reduced ABR associated with increased AT knockdown and thrombin generation • In small number of patients, ABR=0 at AT knockdown >66% (p <0.001) Maximum bleed-free interval of 114 days in severe hemophil
Slide 20: Complement Disease Program
GENETIC MEDICINES Complement Disease Program Unmet Need and Program Opportunity Wide range of complement-mediated diseases • Excessive complement activity drives disease pathophysiology in many indications ◦ Paroxysmal nocturnal hemoglobinuria (PNH) ◦ Atypical hemolytic uremic syndrome (aHUS) ◦ Neur
Slide 21: Complement C5 and ALN-CC5 Program
GENETIC MEDICINES Complement C5 and ALN-CC5 Program Alternative Pathway Classical Pathway Lectin Pathway Initiation C3 C1 Complement C5 is genetically validated target C3 C4 and C2 • Key component of terminal pathway C3 Convertase Factor B ◦ C5 cleavage releases C5a; initiates C3bBb C4bC2a membrane
Slide 22: ALN-CC5 Phase 1/2 Study
GENETIC MEDICINES ALN-CC5 Phase 1/2 Study Dose-Escalation Study Including Patients with PNH PART A PART B PART Study Design C • Randomized, double- Study Design blind, placebo-controlled • Randomized, double- Study Design SAD study in healthy blind, placebo-controlled • Open-label MAD study in volun
Slide 23: ALN-CC5 Initial SAD Phase 1/2 Results
GENETIC MEDICINES ALN-CC5 Initial SAD Phase 1/2 Results Potent C5 Knockdown and Inhibition of Complement Activity C5 knockdown and complement inhibition with single dose ALN-CC5 • Potent, dose-dependent, and durable C5 knockdown up to 96% ◦ Mean maximum knockdown of 94 ± 2.0% (p <0.003 vs. placebo);
Slide 24: Acute Intermittent Porphyria (AIP) Program
GENETIC MEDICINES Acute Intermittent Porphyria (AIP) Program Unmet Need, Product Opportunity, and Program Status AIP is autosomal dominant disorder • Ultra-rare orphan disease ◦ ~5,000 Patients with annual attacks U.S./EU ◦ ~500 Patients with recurrent attacks U.S./EU High unmet need and cost • Pati
Slide 25: AAT Deficiency-Associated Liver Disease
GENETIC MEDICINES AAT Deficiency-Associated Liver Disease Unmet Need, Product Opportunity, and Program Status Alpha-1 liver disease is autosomal disorder • Commonest mutant allele (PiZZ) homozygosity results in liver cirrhosis • Z-AAT protein misfolds and aggregates in hepatocytes ◦ Leads to liver i
Slide 26: Development Pipeline: Cardio-Metabolic Diseases
WLAlnylam. Development Pipeline CARDIO-METABOLIC DISEASES Hypercholesterolemia Hypertriglyceridemia Mixed Hyperlipidemia/Hypertriglyceridemia Hypertension/Preeclampsia Additional Cardio-Metabolic Programs DISCOVERY ALN-AC3 ALN-ANG ALN-AGT DEVELOPMENT
Slide 27: PCSK9 and ALN-PCSsc Program
CARDIO-METABOLIC DISEASE PCSK9 and ALN-PCSsc Program Unmet need in hypercholesterolemia • Elevated LDL-C validated risk factor for coronary heart disease (CHD) • 34 million Americans have hypercholesterolemia (> 240 mg/dL) • Recent clinical studies ◦ Many patients on statins do not meet LDL-C goal ◦
Slide 28: Initial ALN-PCSsc Phase 1 Study Results
CARDIO-METABOLIC DISEASE Initial ALN-PCSsc Phase 1 Study Results Support once-quarterly and possibly bi-annual, low volume, subcutaneous dose regimen profile • Up to 94% maximal and up to 88% mean maximum PCSK9 knockdown (p<0.001) • Up to 83% maximal and up to 64% mean maximum LDL-C lowering (p<0.00
Slide 29: Cardio-Metabolic Disease
CARDIO-METABOLIC DISEASE 29
Slide 30: Hepatitis B Virus (HBV) Infection
HEPATIC INFECTIOUS DISEASE Hepatitis B Virus (HBV) Infection Chronic HBV (CHB) infection is significant WW problem • One third of world population infected • 400M people with chronic disease ◦ 25M in U.S./EU • Most unaware of infection • High prevalence expected for next 3 decades ◦ Despite availabi
Slide 31: RNAi Therapeutics for HBV: Efficacy in Chimpanzees
HEPATIC INFECTIOUS DISEASE RNAi Therapeutics for HBV Efficacy in HBV-Infected Chimpanzees Dose-dependent antiviral response with intra-subject ascending doses • Mean 2.9 log10 decrease in viral DNA day 2-6 post 0.5 mg/kg dose ◦ >4 log10 reduction in circulating viral DNA achieved in highest titer an
Slide 32: ALN-HBV Development Candidate
HEPATIC INFECTIOUS DISEASE ALN-HBV Development Candidate (DC) Potent ESC-GalNAc-Conjugate for SC Administration Potent, multi-log HBsAg knockdown in murine model • Mouse model with AAV-HBV vector • ALN-HBV DC achieves potent knockdown of HBsAg ◦ Single SC dose of siRNA at 3 mg/kg; specificity confir
Slide 33: Guidance and Goals
Guidance and Goals HARMACEUTICALS
Slide 34: Alnylam STArs: Marketed Products and Clinical Programs
ZL Alnylam. 3 STArs 3 Marketed Products 10 Clinical Programs 4 Late Stage Programs
Slide 35: Alnylam 2015 Pipeline Goals
Alnylam 2015 Pipeline Goals 2015 * Early is Q1-Q2, Mid is Q2-Q3, and Late is Q3-Q4; **IND or IND equivalent Early Mid Late Ongoing APOLLO Phase 3 Accrual PATISIRAN Phase 2 OLE data (TTR-FAP) Start Phase 3 OLE ENDEAVOUR Phase 3 Accrual REVUSIRAN Phase 2 OLE Data (TTR-FAC) Natural History Results Phas
Slide 36: Select Scientific and Clinical Meetings
Select Scientific and Clinical Meetings Mid-to-Late ’15 ALN-PCSsc European Society of Cardiology (ESC) August 29-September 2 (London) ALN-GO1 European Society for Paediatric Nephrology (ESPN) September 3-5 (Brussels) International Congress of Porphyrins and Porphyrias ALN-AS1 September 12-16 (Dussel
Slide 37: Financial Summary and Guidance
Financial Summary and Guidance 2015 Q2 Financial Results • Cash ~$1.40B • GAAP Revenues $8.7M • Total GAAP Operating Expenses $81.6M ◦ Research and Development Expense $67.0M ◦ General and Administrative Expense $14.6M • GAAP Net Loss of $71.8M • Shares Outstanding ~84.5M 2015 Guidance • Year-end ca
Slide 38: Thank You
Thank You www.alnylam.com 38
Alnylam Pharmaceuticals — Investor Presentation (September 2015) on 6ix