Lexeo Therapeutics, Inc. · NASDAQ:LXEO
Lexeo Therapeutics — ASGCT 2026
21 slides from Lexeo Therapeutics's conference presentation, May 12, 2026
Slide 1: A Gene Therapy Approach for the Treatment of TNNI3 Cardiomyopathy
A Gene Therapy Approach for the Treatment of TNNI3 Cardiomyopathy Darla Tharp, Bhanu Telugu, Elizabeth Silver, Betul Gunes, Julius Bogomolovas, Eryn Wagoner, Brittany Mezzancella, Ashley Clark, Sean Simpson, Ki Eun Park, Jerel Waters, Claire Geddes, Kevin King, Ju Chen, Eric Adler ASGCT 2026 | Bosto
Slide 2: Outline
Outline • Background: Thin Filament Hypertrophic Cardiomyopathy • TNNI3 Cardiomyopathy in Humans • Mouse Model of TNNI3 • Swine Model of TNNI3 • AAV Gene Therapy
Slide 3: Background: Thin Filament Hypertrophic Cardiomyopathy (HCM)
Background: Thin Filament Hypertrophic Cardiomyopathy (HCM) • Thin-filament mutations: ~20% of HCM cases • High Mortality • Cardiac Hypertrophy (Shave 2010) • Impaired Relaxation
Slide 4: TNNI3 Cardiomyopathies are a Distinct and Lethal Form of HCM
TNNI3 Cardiomyopathies are a Distinct and Lethal Form of HCM • TNNI3 mutations: 3-5% of HCM cases • Characterized by increased mortality, hypertrophy, and diastolic dysfunction • No current targeted therapies Family with TNNI3-cardiomyopathy (A157V variant) Van Driet 2003, Keyt 2022, and Saul 2024
Slide 5: Mouse model of TNNI3 A158V shows impaired cardiac relaxation but no fibrosis and normal lifespan
Mouse model of TNNI3 A158V shows impaired cardiac relaxation but no fibrosis and normal lifespan A158V Exons 1 2 3 4 5 6 7 8 TnI I S Mobile 100% 1-year survival CRISPR/Cas9 No hypertrophy Homozygous TNNI3 No systolic dysfunction A158V knock-in No fibrosis Silver et al, JAHA 2025
Slide 6: Objectives
Objectives • Establish and characterize a large animal model of TNNI3 hypertrophic cardiomyopathy which recapitulates the human disease • Test a novel TNNI3 Gene Therapy
Slide 7: Porcine TNNI3 A158V
sgRNA Porcine TNNI3 A158V (cccagcagugccugcaucau) Ex 6 Ex 7 Ex 8 D A M M Q A L L G A R gat gcc atg atg cag gca ctg ctg ggg gcc agg D A M M Q V L L G A R …gat gcA atg atg caA gTa ctA ctT ggg gcc agg… RsaI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 +C -C Bhanu Telugu
Slide 8: Survival Data
Survival Data 1.0 WT (4) Probability of Survival TNNI3 mut (8) 0.5 0.0 0 50 100 Days TNNI3 mutant pigs have increased mortality
Slide 9: Wall Thickness
Wall Thickness Relative Wall Thickness (Echo) Gross Wall Thickness (mm) 25 * 0.5 0.4 20 * 0.3 15 0.2 10 0.1 5 0.0 0 WT TNNI3 WT TNNI3 *p<0.05 vs. WT TNNI3 mutant pigs have hypertrophy
Slide 10: End Diastolic and End Systolic Volumes
End Diastolic (EDV) and End Systolic Volume (ESV) Volumes 50 25 40 * 20 * LV EDV (mL) LV ESV (mL) 30 15 20 10 10 5 0 0 WT TNNI3 WT TNNI3 *p<0.05 vs. WT TNNI3 mutant pigs have reduced EDV and ESV
Slide 11: Left Ventricular and Atrial Function
Left Ventricular and Atrial Function 15 * 80 60 10 * LA EF% E/E' 40 5 20 0 0 WT TNNI3 WT TNNI3 *p<0.05 vs. WT TNNI3 mutant pigs have LV and LA Dysfunction
Slide 12: 2D Longitudinal Echocardiography
2D Longitudinal Echocardiography Wild-Type Control TNNI3 Mutant TNNI3 mutant pigs recapitulate human disease
Slide 13: TNNI3 Gene Therapy Construct: MyoAAV-hTNNI3
TNNI3 Gene Therapy Construct: MyoAAV-hTNNI3 Previously described and published construct (Bushway et al., 2026) Capsid: MyoAAV • Transgene: Full-length human TNNI3 cDNA • Regulatory elements: MCK enhancer upstream of the human TNNT2 promoter, augmented by MYH6-derived regulatory elements and polyade
Slide 14: Delivery and Expression
AAV Gene Therapy Delivery and Expression 6 x 1013 vg/kg BW Delivered IV at 1 Week of Age dPCR analysis of cardiac VCN 100000 AAV genome copies per ug DNA AAV TNNI3 10000 1000 100 10 LA LVM-LAT SEP-MID Heart region sampled for analysis 14
Slide 15: Survival Data
Survival Data 1.0 WT (4 pigs) Probability of Survival TNNI3 mut (8 pigs) AAV (3 pigs) 0.5 0.0 0 50 100 Days AAV Gene Therapy Improved Survival
Slide 16: Left Ventricular Wall Thickness and Mass
Left Ventricular Wall Thickness and Mass P=0.057 60 Relative Wall Thickness 0.5 * 0.4 LV mass (g) 40 0.3 0.2 20 0.1 0.0 0 WT TNNI3 AAV WT TNNI3 AAV *p<0.05 vs. WT AAV Gene Therapy Reduced Hypertrophy
Slide 17: End Diastolic (EDV) and End Systolic (ESV) Volumes
End Diastolic (EDV) and End Systolic (ESV) Volumes 50 30 40 * 4D LV EDV (mL) 4D LV ESV (mL) 20 30 * 20 10 10 0 0 WT TNNI3 AAV WT TNNI3 AAV *p<0.05 vs. WT AAV Gene Therapy Improved EDV and ESV
Slide 18: Left Ventricular and Atrial Function
Left Ventricular and Atrial Function 15 * 80 60 † 10 * LA EF% E/E' 40 5 20 0 0 *p<0.05 vs. WT WT TNNI3 AAV WT TNNI3 AAV †p<0.05 vs. WT and TNNI3 AAV Gene Therapy Improved LV and LA function
Slide 19: AAV Gene Therapy as a Treatment of TNNI3 Cardiomyopathy
2D Longitudinal Echocardiography TNNI3 Mutant AAV AAV Gene Therapy as a Treatment of TNNI3 Cardiomyopathy
Slide 20: Summary
Summary • Pig Model of TNNI3 Cardiomyopathy • Mortality • Hypertrophy • Reduced Cardiac Function • AAV Gene Therapy Treatment • Reduced Mortality • Reduced Hypertrophy • Improved Cardiac Function
Slide 21: Acknowledgements
Acknowledgements Claire Geddes Brian Busser Holly Szczepanski Eric Adler Bhanu Telugu Darla Tharp Lab Elizabeth Silver Cardiologist and Professor Associate Professor, MU Assistant Professor, MU Betul Gunes of Medicine, UCSD Sean Simpson Brittany Mezzancella Senior Clinical and Scientific Julius Bogo