Qiagen N.v. · NYSE:QGEN
Qiagen — 34th Annual J.P. Morgan Healthcare Conference, January 2016
26 slides from Qiagen's conference presentation, Jan 12, 2016
Slide 1: QIAGEN: Making improvements in life possible
QIAGEN: Making improvements in life possible Peer M. Schatz Chief Executive Officer 34th Annual J.P. Morgan Healthcare Conference, January 2016 Sample to Insight J.P. Morgan Healthcare Conference, January 2016 1
Slide 2: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 3: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT BUILDING BLOC
Slide 4: Customers want molecular insights
Customers want molecular insights Faster Better More efficiently i The opportunity: Address demands for differentiated molecular testing solutions Sample to Insight J.P. Morgan Healthcare Conference, January 2016 4
Slide 5: QIAGEN at a glance
QIAGEN at a glance 2014 sales ~$1.35 billion Customers >500,000 Global reach >35 countries Employees ~4,500 Share listings NASDAQ / Frankfurt Headquarters Netherlands We help customers gain insights to improve healthcare and advance science Sample to Insight J.P. Morgan Healthcare Conference, Januar
Slide 6: World leader in molecular testing solutions that enable valuable insights
SAMPLE TO INSIGHT SOLUTIONS Sample Technologies Assay Technologies Bioinformatics Automation VALUABLE BIOLOGICAL MOLECULAR SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sample to Insight J.P. Morgan Healthcare Conference, January 2016 6
Slide 7: Addressing the needs of >500,000 customers worldwide
QIAGEN sales by product group As % of 2014 net sales: $1.35 billion Molecular Diagnostics Consumables ~50% of sales (incl. bioinformatics) ~87% Applied Testing Pharma Life Sciences ~50% of sales ~13% Academia Instruments and automation solutions Addressing the needs of >500,000 customers worldwide S
Slide 8: This is how QIAGEN makes improvements in life possible
This is how QIAGEN makes improvements in life possible Sample to Insight J.P. Morgan Healthcare Conference, January 2016 8
Slide 9: One core focus: Sample to Insight in molecular testing solutions
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other PCR Technologies NGS Assay QuantiFERON Other Software and Biox biological content TB / Immune Infectious Human ID / Pharma Life
Slide 10: Investing across our Sample to Insight portfolio
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other Investing across our PCR Technologies NGS Assay QuantiFERON Sample to Insight portfolio Other Software and Biox biological conte
Slide 11: Transforming QIAGEN to leadership in Molecular Diagnostics and Life Sciences
Molecular Applied Adjusted net sales overview: 2010-2014 Diagnostics Testing Pharma Academia (In $ billions, as percentage of sales) QIAsymphony $1.35 bn $1.25 bn Personalized Healthcare (PHC) $1.09 bn ~30% ~22% ~15% QuantiFERON-TB Bioinformatics ~68% ~65% ~64% GeneReader NGS System QIAseq universal
Slide 12: Selected 2015 highlights: Strengthening our Sample to Insight portfolio
Most trusted brand for Sample Technologies Leader in molecular oncology testing Pioneer in bioinformatics Driving molecular testing dissemination Key player in the global war against TB Selected 2015 highlights: Strengthening our Sample to Insight portfolio Sample to Insight J.P. Morgan Healthcare C
Slide 13: Liquid biopsy: Expanding our No. 1 Sample Technology position
Liquid biopsy: Expanding our No. 1 Sample Technology position Liquid biopsy targets 2015 highlights Automation of fcDNA on QIAsymphony 5 new companion diagnostic collaborations Addition of AdnaGen CTC technology 2016 catalysts Ongoing strong sales growth New NGS sequencing applications C
Slide 14: MO BIO: World leader in DNA and RNA isolation for microbiome projects
New Strengthening our differentiated Sample Technology portfolio MO BIO: late 2015 acquisition Microbiome: fast growing area in research and clinical Challenge: extremely complex samples (skin, feces, soil, waste water, etc.) Patented Inhibitor Removal Technology® Complements QIAGEN’s port
Slide 15: Expanding our leadership in molecular oncology testing
Expanding our leadership in molecular oncology testing QIAGEN molecular testing portfolio 2015 highlights PCR NGS ModaPlex Leading industry with >15 pharma master collaborations Speed Multiple molecular solutions from one supplier Broadening indications beyond cancer Cost Pioneer: first liqu
Slide 16: The challenge
The challenge The demand Fragmented Analyzing and Efficient Complete High costs Cost-effective workflows interpreting data to operate workflow Many barriers hampering NGS utilization Labs have consistent views on NGS demands The world’s first complete Sample to Insight NGS solution for actionable re
Slide 17: The world's first complete Sample to Insight NGS solution for actionable results
Sample type Unique Reliable Powerful analysis breadth automation results and interpretation QIAcube® GeneRead QIAcube® GeneReaderTM Bioinformatics portfolio NGS SAMPLE PREPARATION ALIGNMENT / PRIMARY ANALYSIS / SAMPLE NGS RUN TARGET LIBRARY CLONAL INTERPRETATION / TECH ENRICHMENT PREP AMPLIFICATION
Slide 18: Key benefits of GeneReader NGS System
Key benefits of GeneReader NGS System 1. First complete NGS workflow 2. Actionable insights Seamless integration Reports linked to proven gene panel Single vendor for full solution Highest-quality bioinformatics platform 3. High flexibility 4. Guaranteed results 5. Expertise and service Sc
Slide 19: Pioneer in Bioinformatics
Pioneer in Bioinformatics QIAGEN Bioinformatics at a glance 2015 highlights QIAGEN Clinical Insight: scalable NGS testing >120,000 users worldwide CLC / Intel whole genome analysis collaboration New solutions on CLC Genomic Workbench 40 of the 40 top Pharma companies rely on QIAGEN bioinformat
Slide 20: Expanding use to seven U.S. FDA centers
Current FDA site New FDA site expansion CBER NCTR CFSAN CFSAN Center for National Center Center for Food Safety Center for Food Safety Biologics Evaluation for Toxicological and Applied Nutrition and Applied Nutrition and Research Research CDER CDRH CMV Center for Center for Center for Drug Evaluati
Slide 21: Driving molecular testing dissemination
New Driving molecular testing dissemination QIAsymphony system placements 2015 highlights >250 new placements achieved Achieved 2015 target >1,500 Integrated solutions as well as front-end utility for downstream applications (e.g. NGS) Launch of seven new CE-IVD tests >1,250 New U.S. forensi
Slide 22: QuantiFERON-TB: Key player in global war against TB
QuantiFERON-TB: Key player in global war against TB Latent tuberculosis (TB)(1) 2015 highlights ~7 million tests and double-digit CER growth CE-IVD clearance of 4th generation QuantiFERON-TB Gold Plus 1 in 3 people EU immigration screening programs worldwide… has latent TB 2016 catalysts And o
Slide 23: Selected QIAGEN portfolio areas
Selected QIAGEN portfolio areas 2015 2016 results outlook Growth drivers: Adjusted net sales: QIAsymphony ~+6% CER / - 2 p.p. FX QuantiFERON Adjusted diluted EPS: CER growth with sales / - 2 p.p. FX Personalized Q4: CDx partner Healthcare milestone timing Key investment areas
Slide 24: Delivering free cash flow gains and improving balance sheet efficiency
Free cash flow trends Leverage ratio: Net debt / adjusted EBITDA(1) 3.5 3.3 $163 m 3.0 $149 m 2.5 2.2 $121 m 2.0 1.5 1.5 1.2 1.1 0.9 0.9 1.0 0.5 0.4 0.2 0.0 9M 2013 9M 2014 9M 2015 - 0.1 -0.5 2006 2006 2008 2008 2010 2010 2012 2012 2014 Q3 2014 Q3 2015 2015 Delivering free cash flow gains and improv
Slide 25: Disciplined capital allocation
DISCIPLINED CAPITAL ALLOCATION Reinvest for organic growth Increase returns Targeted M&A / licensing Strengthen our premium > $500 m returned to Continuing our strategy Sample to Insight portfolio shareholders (2013-2015) Novel technologies Repurchases of shares Molecular test content an
Slide 26: Summary
Summary Expanding leadership in Sample to Insight solutions Leading positions in the most exciting areas of molecular diagnostics and life sciences Delivering growth during transformation 2016: Moving into a faster growth phase Sample to Insight J.P. Morgan Healthcare Conference, January 2016 26
Qiagen — 34th Annual J.P. Morgan Healthcare Conference, January 2016 on 6ix