Slide 1: Investor presentation Q3 2016
Investor presentation Q3 2016 Sample to Insight
Slide 2: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 3: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q3 2016 3
Slide 4: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG BUILDING BLOCKS OF LIFE AACAAGTTAA
Slide 5: Customers want molecular insights
Customers want molecular insights Faster Better More efficiently i The opportunity: Address demands for differentiated molecular testing solutions Sample to Insight Investor presentation Q3 2016 5
Slide 6: QIAGEN at a glance
QIAGEN at a glance 2015 sales ~$1.3 billion Customers >500,000 Global reach >35 countries Employees ~4,600 Share listings NASDAQ / Frankfurt Headquarters Netherlands We help customers gain insights to improve healthcare and advance science Sample to Insight Investor presentation Q3 2016 6
Slide 7: World leader in molecular testing solutions that enable valuable insights
SAMPLE TO INSIGHT SOLUTIONS Sample Technologies Assay Technologies Bioinformatics Automation systems VALUABLE BIOLOGICAL MOLECULAR SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sample to Insight Investor presentation Q3 2016 7
Slide 8: Expanding worldwide sales in established and emerging markets
Targeting high-growth markets Diversified global presence QIAGEN net sales in top 7 emerging markets 2015 adjusted net sales: $1.3 billion (In % of total QIAGEN sales) (In % of total QIAGEN sales) ~15% Europe / ~14% Middle East / ~32% ~12% Africa ~9% ~47% Americas Asia-Pacific / Japan / ~21% Rest of
Slide 9: Addressing the needs of >500,000 customers worldwide
QIAGEN sales by product group (As % of 2015 net sales: $1.3 billion) Molecular Diagnostics Consumables ~50% of sales (incl. bioinformatics) ~87% Applied Testing Pharma Life Sciences ~50% of sales ~13% Academia Instruments and automation solutions Addressing the needs of >500,000 customers worldwide
Slide 10: Building leadership across Life Sciences and Molecular Diagnostics
QIAGEN sales by customer class (As % of annual net sales) $1.3 bn $1.3 bn $1.2 bn 23% 22% Academia $1.0 bn 26% Life Sciences 26% 19% 20% Pharma 20% 8% 9% Applied Testing 21% 7% 3% U.S. HPV 10% 6% 15% 20% Molecular 46% Rest of portfolio Diagnostics 40% 32% 27% 2009 2011 2013 2015 MDx portfolio Applie
Slide 11: Q2 2016 results show QIAGEN at inflection point for new sales growth trajectory
2015-2016E: Quarterly sales growth trends 2013-2016E: Annual sales growth trends (At constant exchange rates for comparative quarter) (At constant exchange rates for comparative annual year) 10% 10% 8% 8% 6% 6% 4% 4% 2% 2% 0% 0% Q1 Q2 Q3 Q4 Q1 Q2 Q3 FY FY FY YTD FY 2015 2015 2015 2015 2016 2016 2016
Slide 12: One core focus: Sample to Insight in molecular testing solutions
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other PCR Technologies NGS Assay QuantiFERON Other Software and Biox biological content TB / Immune Infectious Human ID / Pharma Life
Slide 13: Following a clear strategic development plan
1984 – 2000 2000 – 2004 2004 – 2013 >2014 COMPONENTS AUTOMATION WORKFLOWS SAMPLE TO INSIGHT SOLUTIONS Offer individual Automate individual Develop integrated Create hyper-connected technologies workflow steps automated workflows and high-utility solutions with full test menu Following a clear strate
Slide 14: Transforming QIAGEN to leadership in Molecular Diagnostics and Life Sciences
Molecular Applied Adjusted net sales overview: 2011-2015 Diagnostics Testing Pharma Academia In $ billions, as percentage of sales QIAsymphony $1.3 bn $1.3 bn Personalized $1.2 bn Healthcare (PHC) ~25% ~33% ~18% QuantiFERON-TB Bioinformatics ~67% ~65% ~64% GeneReader NGS System QIAseq universal solu
Slide 15: Leveraging the potential of QIAGEN's Sample to Insight portfolio
Sample Technologies QuantiFERON-TB GeneReader NGS System QIAseq universal solutions Personalized Healthcare (PHC) QIAsymphony Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight Investor presentation Q3 2016 15
Slide 16: Sample Technologies: Most trusted brand
Sample Technologies: Most trusted brand QIAGEN: #1 in Sample Technologies Needs QIAGEN offering Dedicated solutions for Differentiated and automated challenging samples types Sample Technology portfolio Highest level of quality Industry leader for liquid to extract biological targets biopsy
Slide 17: QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis
QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis Latent TB testing total addressable market: $1 bn Needs QIAGEN offering Tuberculosis (TB) still a More than 7 million tests major global health burden delivered in 2015 Addressing latent TB critical New gold standard, repla
Slide 18: NGS: Driving dissemination into routine clinical use
NGS: Driving dissemination into routine clinical use ~80% of all NGS runs conducted on samples processed with QIAGEN Needs QIAGEN offering NGS workflows still hampered GeneReader: by many bottlenecks First complete Sample to Insight NGS solution Systems tailored for the clinical community >8
Slide 19: Personalized Healthcare: Pioneer in companion diagnostics
Personalized Healthcare: Pioneer in companion diagnostics Record number of 16 master collaboration agreements Needs QIAGEN offering Avoid “trial-and-error” 4 FDA approved tests medicine First CE-IVD liquid biopsy Improve treatment CDx for Iressa in lung cancer outcomes for patients Broades
Slide 20: QIAsymphony: Driving molecular testing dissemination
QIAsymphony: Driving molecular testing dissemination 2016 target: >1,750 installed systems Needs QIAGEN offering Flexible sample processing Continuous loading for highest level of flexibility Standardized workflow to ensure quality and safety Efficient and reliable sample preparation Compr
Slide 21: Bioinformatics: Best in-class data analysis and interpretation
Bioinformatics: Best in-class data analysis and interpretation Expected output of NGS data in 2015: 1.5 billion DVDs Needs QIAGEN offering NGS drives sharp increase in Global market leader in output of raw biological data commercial bioinformatics Emerging clinical >420,000 samples analyzed
Slide 22: Disciplined capital allocation
DISCIPLINED CAPITAL ALLOCATION Reinvest for organic growth Increase returns Targeted M&A / licensing Strengthen our premium >$500 m returned to Continuing our strategy Sample to Insight portfolio shareholders (2012-2015) Novel technologies Increased commitment to Molecular test content r
Slide 23: Summary
Summary Expanding leadership in Sample to Insight solutions Leading positions in the most exciting areas of molecular diagnostics and life sciences Delivering growth during transformation 2016: Setting QIAGEN on a course to accelerate growth and drive further innovation Sample to Insight Investor pr
Slide 24: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q3 2016 24
Slide 25: Sample Technologies
Sample Technologies Free circulating nucleic acids RNA and DNA from dead cells shed into the bloodstream, can contain cancer- related mutations. Exosomes Tiny microvesicles found in body fluids that transport RNA between cells. Circulating tumor cells Tumor cells shed from a tumor into the bloodstre
Slide 26: Sample Technologies
Sample Technologies QIAamp QIAsymphony Free circulating nucleic acids exoRNAeasy Exosomes QIAcube REPLI-g and AdnaGen Circulating tumor cells (CTCs) Setting the standards for liquid biopsy sample technologies Sample to Insight Investor presentation Q3 2016 26
Slide 27: Sample Technologies
Sample Technologies Strengthening our differentiated Sample Technology portfolio MO BIO: late 2015 acquisition Microbiome: fast growing area in research and clinical Challenge: extremely complex samples (skin, feces, soil, waste water, etc.) Patented Inhibitor Removal Technology® Complemen
Slide 28: QuantiFERON-TB: latent tuberculosis infection
QuantiFERON-TB Latent tuberculosis infection (LTBI) Latent tuberculosis test target groups Public health TB control 1 in 3 people Employment Medical staff worldwide… screening Fire and police exposed to TB Congregated Correctional sites will develop latent TB living Military Universities
Slide 29: QuantiFERON-TB
QuantiFERON-TB Tuberculin Skin Test (1890s) QuantiFERON-TB (2000s) 2-4 visits required Single visit, results in <24 hours Subjective, low specificity: 65.9% Objective, high specificity: 99.2% Not reliable for TB-vaccinated people Can rule out use of BCG vaccine Proven clinical and workfl
Slide 30: Next-generation sequencing
Next-generation sequencing Ease of use Reliable results Unique automation Data interpretation QIAcube® GeneRead QIAcube® GeneReaderTM Bioinformatics portfolio NGS SAMPLE PREPARATION ALIGNMENT / PRIMARY ANALYSIS / SAMPLE NGS RUN TARGET LIBRARY CLONAL INTERPRETATION / TECH ENRICHMENT PREP AMPLIFICATIO
Slide 31: Key benefits of GeneReader NGS System
Next-generation sequencing Key benefits of GeneReader NGS System 1. First complete NGS workflow 2. Actionable insights Seamless integration Reports linked to proven gene panel Single vendor for full solution Highest-quality bioinformatics platform 3. High flexibility 4. Guaranteed results 5.
Slide 32: Next-generation sequencing
Next-generation sequencing QIAseq Traditional Feature “Digital NGS” approaches “Digital NGS” with QIAseq Higher sensitivity and Proprietary “Digital NGS” leverages higher specificity Molecular Index technology for use Accurate detection of in universal NGS assay panels even very rare variants Ke
Slide 33: Personalized Healthcare
Personalized Healthcare Selected partners QIAGEN: CDx partner of choice No. 1 in PCR-based companion diagnostics FDA approvals: KRAS and EGFR Selected key success factors Broadest platform range (PCR / NGS / Modaplex) Linking content and interpretation Independence Regulatory and reimb
Slide 34: QIAsymphony
QIAsymphony 2016 goal: Breaking through >1,750 installed systems Molecular Diagnostics Applied Testing Academia / Pharma Healthcare-acquired infections Forensics / Human ID Translational medicine Women’s health Veterinary medicine Gene panels / Food safety Biomarker testing Transplan
Slide 35: Bioinformatics
Bioinformatics Preparation Sequencing Analysis Interpretation CLC Ingenuity Discovery RNA-Seq Genomic Pathway Workbench Analysis CLC Ingenuity Discovery DNA-Seq Genomic Variant Workbench Analysis Ingenuity BIOLOGICAL CLC Cancer VALUABLE Translational DNA-Seq Variant SAMPLE Workbench MOLECULAR Analys
Slide 36: Bioinformatics
Bioinformatics QIAGEN Clinical Insight Fully integrated, web-based workflow Allows scaling of NGS test service offerings Comprehensive and rapid annotation, classification and reporting of variants Somatic and hereditary cancer tests at start Built for full regulatory and data security nee
Slide 37: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q3 2016 37
Slide 38: 2015: Quarterly and full-year results overview
2015: Quarterly and full-year results overview In $ millions Q1 2015 Q2 2015 Q3 2015 Q4 2015 Full-year (Except EPS) 2015 Adjusted net sales 298.7 319.5 314.6 348.5 1,281.2 Adjusted gross profit 218.1 225.7 222.3 246.0 912.0 Adjusted gross profit margin 73% 71% 71% 71% 71% Adjusted operating income 6
Slide 39: Full-year 2015: Adjusted net sales and EPS
Full-year 2015: Adjusted net sales and EPS 2015 adjusted net sales development 2015 adjusted diluted EPS development (In $ billions) (In $ per share) +$0.13 $1.13 CER CER -$0.08 +3% CER $1.05 $1.35 bn -5% $1.00 $1.28 bn -3 p.p. +6% CER -8% p.p. ~3% ~97% of sales of sales 2014 2015 2015 2015 FX 2015
Slide 40: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q3 2016 40
Slide 41: Q2 2016: Overview
Q2 2016: Overview Change 1 In $ millions Strong performance in Q2 2016 (Except EPS) Q2 2016 Q2 2015 $ / (CER) +5% / +6% CER net sales above 4% CER target Net sales 334.4 319.5 (+6%) +8% CER sales growth from 98% of portfolio Operating income 29.5 40.0 -26% excluding U.S. HPV tests Operating inco
Slide 42: Q2 and H1 2016: Net sales by customer classes
Q2 and H1 2016: Net sales by customer classes Q2 2016 net sales: $334.4 million H1 2016 net sales: $632.8 million Consumables and related revenues $291.8 m / +6% CER / ~87% of sales $554.1 m / +4% CER / ~88% of sales Instruments $42.6 m / +3% CER / ~13% of sales $78.7 m / +4% CER / ~12% of sales MDx
Slide 43: Q2 2016: Achievements
Q2 2016: Achievements Sample Technologies QuantiFERON-TB Next-generation Sequencing Solid single-digit CER growth in Ongoing sales growth above 25% GeneReader NGS System’s core sample technology portfolio CER, even faster trend in U.S. Actionable Insight Tumor Panel for MO BIO microbiome kit
Slide 44: >$100 million opportunity: new H2 2016 product launches
Life Sciences: New wave of novel H2 2016 product launches EGFR KRAS Liquid biopsy Digital NGS BRAF Single-cell analysis ALK … PAXgene Blood cell-free DNA QIAseq “Digital NGS” panels QIAseq Single-Cell Library Kits Integrating collection, For DNA, RNA and miRNA For DNA and RNA stabili
Slide 45: Q2 2016: Income statement summary
Q2 2016: Income statement summary In $ millions (Unless indicated / Diluted EPS in $ per share) Q2 2016 Q2 2015 Change Net sales 334.4 319.5 5% Net sales (CER) 338.1 319.5 6% Gross profit 210.9 200.5 5% Gross profit margin 63% 63% Adjusted gross profit 234.4 225.7 4% Adjusted gross profit margin 70%
Slide 46: Q2 2016: Reconciliation adjusted results
Q2 2016: Reconciliation adjusted results In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 334.4 210.9 29.5 22.6 -1.6 7% 21.0 0.09 Adjustments Business integration 3.5 9.9 9.9 -2.6 7.3 0.03 and acquisition-rel
Slide 47: H1 2016: Income statement summary
H1 2016: Income statement summary In $ millions (Unless indicated / Diluted EPS in $ per share) H1 2016 H1 2015 Change Net sales 632.8 617.9 2% Net sales (CER) 643.7 617.9 4% Gross profit 395.6 398.4 -1% Gross profit margin 63% 64% Adjusted gross profit 441.8 443.8 0% Adjusted gross profit margin 70
Slide 48: H1 2016: Reconciliation adjusted results
H1 2016: Reconciliation adjusted results In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 632.8 395.6 44.9 31.5 4.4 NM 35.9 0.15 Adjustments Business integration 6.4 18.3 18.3 -5.4 12.9 0.06 and acquisition-r
Slide 49: H1 2016: Balance sheet and cash flow
H1 2016: Balance sheet and cash flow Balance sheet data Leverage ratio(1) (As of June 30) 2016 2015 Group liquidity (In $ millions) 406 368 3.5 3.3 Net debt (In $ millions) 669 686 3.0 Shareholder equity ratio 64% 61% 2.5 Leverage ratio(1) 1.7x 1.6x 2.2 2.0 1.6 1.7 1.5 1.3 Cash flow 1.1 (In $ millio
Slide 50: FY 2016: Updating full-year 2016 targets
FY 2016: Updating full-year 2016 targets As of July 28, 2016 (updated for Exiqon acquisition) 2016 adjusted net sales outlook 2016 adjusted diluted EPS outlook (At constant exchange rates, and as percentage of sales) (In $ per share) ~+6% CER ~$1.10-1.11 CER(1) ~+6-7% CER(1) Exiqon acquisition (June
Slide 51: Q3 and full-year 2016: Outlook and assumptions
Q3 and full-year 2016: Outlook and assumptions As of July 28, 2016 (updated for Exiqon acquisition) Q3 2016 outlook Full-year 2016 outlook Net sales ~+8-9% CER ~+6-7% CER ~$0.28 CER ~$1.10-1.11 CER Adjusted diluted EPS(1) (Prior year: $0.27) (Prior year: $1.05) Amortization of acquired intellectual
Slide 52: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q3 2016 52
Slide 53: Global reach into the most attractive geographic markets
Global reach into the most attractive geographic markets Aarhus Manchester Hilden Venlo Redwood Waltham Germantown City Shanghai Shenzhen Hilden, Germany Europe Germantown, Maryland Americas Shanghai Asia-Pacific Sample to Insight Investor presentation Q3 2016 53
Slide 54: H1 2016: Employees as of June 30, 2016
H1 2016: Employees as of June 30, 2016(1) Europe / Total Total Asia Pacific / Americas Middle East / Change Japan / ROW Q2 2016 Q2 2015 Africa Production 302 592 107 1,001 981 2% R&D 217 705 88 1,010 951 6% Sales 597 703 557 1,857 1,712 8% Marketing 83 159 74 316 304 4% Admin 94 295 65 454 444 2% To
Slide 55: Your contacts
Your contacts John Gilardi Dr. Sarah Fakih Alexandra Koenig Vice President Associate Director Coordinator Corporate Communications and IR Investor Relations Investor Relations Phone: +49 2103 29 11711 Phone: +49 2103 29 11457 Phone: +49 2103 29 11709 or +1 240 686 2222 Mobile: +49 152 018 11457 Mobi