Slide 1: Investor presentation Q4 2016
Investor presentation Q4 2016 Sample to Insight
Slide 2: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: This presentation contains both historical and forward-looking statements. All statements other than statements of historical fact are, or may be deemed to be forward looking statements within the meaning of Section 27A of the U.S. S
Slide 3: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q3 2016 results Appendix Sample to Insight Investor presentation Q4 2016 3
Slide 4: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG BUILDING BLOCKS OF LIFE AACAAGTTAA
Slide 5: Customers want meaningful molecular insights
Customers want meaningful molecular insights Faster Better More efficiently Sample Technologies Assay Technologies Bioinformatics Automation systems VALUABLE BIOLOGICAL MOLECULAR SAMPLE TO INSIGHT SOLUTIONS SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sam
Slide 6: World leader in molecular testing solutions that provide valuable insights
QIAGEN at a glance 2015 sales by customer class Leader in molecular testing solutions True hybrid covering continuum from Academia Pharma Applied Molecular Diagnostics Testing Life Sciences to Molecular Diagnostics Core capabilities Consumables ~22% ~20% ~9% ~49% Instruments Automation s
Slide 7: Following a clear strategic development plan
1984 – 2000 2000 – 2004 2004 – 2013 >2014 COMPONENTS AUTOMATION WORKFLOWS SAMPLE TO INSIGHT SOLUTIONS Offer individual Automate individual Develop integrated Create hyper-connected technologies workflow steps automated workflows and high-utility solutions with full test menu Following a clear strate
Slide 8: U.S. HPV sales headwinds obscured QIAGEN's fundamental progress
QIAGEN sales evolution Create a molecular Significant Portfolio Commercial Sustain growth franchise reorganization transformation acceleration and deliver value $1.30 bn $1.33 bn $1.28 bn $1.25 bn $1.17 bn ~6% ~3% $1.09 bn ~10% ~13% ~94% ~97% $1.01 bn ~15% ~90% ~17% ~87% ~20% ~85% ~83% ~80% ≥12% CER
Slide 9: Technologies and customers
Customers Life Sciences Molecular Diagnostics Manuel O. Méndez Academia Pharma Applied Testing Clinical Healthcare Brad Thierry Crutchfield Bernard Scientific Better and Secure Better Examples: breakthroughs safer drugs and protect healthcare Blood #1 Technologies Sample Liquid biopsy #1 Tissue #1 A
Slide 10: Disciplined capital allocation
Disciplined capital allocation Reinvest for organic growth Increase returns Targeted M&A / licensing Capture more value from our Commitment to return $300 Continuing our strategy Sample to Insight portfolio million by end of 2017 Novel technologies New products Future repurchase options
Slide 11: Key efficiency initiatives
Key efficiency initiatives 1 Sales channel optimization Simplify some organizational structures 2 Site consolidation Focus on 3 growth opportunities Business Service Centers 4 Further enhance Portfolio management performance culture Initiatives under way to sustain sales growth momentum while creati
Slide 12: Maximize sales growth, multiple drivers
Strong governance and top talent Maximize sales growth Multiple Deliver operating leverage Value drivers creation Optimize balance sheet Adjusted EPS growth and capital returns Opportunity for near-term value creation on delivery of 2017-2020 goals Sample to Insight Investor presentation Q4 2016 12
Slide 13: Supervisory Board overview
Supervisory Board overview Board tenure (In years) Current Supervisory Board members Prof. Dr. Detlev Riesner Manfred Karobath, M.D. Erik Hornaess Joined 2000 Dr. Manfred Karobath Dr. Metin Colpan Stéphane Bancel Metin Colpan, Ph.D. Dr. Werner Brandt Joined 2013 Joined 2004 Heino von Prondzynski Eli
Slide 14: Executive Committee
CEO Peer Schatz New members since 2014 Molecular Life Bio- Executive Committee Diagnostics Sciences informatics Thierry Brad Laura Bernard Crutchfield Furmanski Commercial Operations Operations Douglas Manuel O. Liu Méndez HR / Corp. CFO Strategy Roland Thomas Sackers Schweins Development Business B
Slide 15: Summary
Summary Reaccelerating performance after transformation Sustainable sales growth and leverage trajectory Emerging as a stronger, focused, differentiated leader Committed to higher returns and greater value creation Sample to Insight Investor presentation Q4 2016 15
Slide 16: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q3 2016 results Appendix Sample to Insight Investor presentation Q4 2016 16
Slide 17: Key highlight areas: QIAGEN's Sample to Insight portfolio
Key highlight areas: QIAGEN’s Sample to Insight portfolio Life Molecular Sciences Diagnostics QuantiFERON Universal NGS solutions and GeneReader NGS System Powered by QIAGEN Bioinformatics Personalized Healthcare QIAsymphony Differentiated Technologies Applications including: ■ Sin
Slide 18: QuantiFERON
QuantiFERON Latent tuberculosis infection (LTBI) Latent tuberculosis test target groups Public health TB control 1 in 3 people Employment Medical staff worldwide… screening Fire and police exposed to TB Congregated Correctional sites will develop latent TB living Military Universities
Slide 19: QuantiFERON
QuantiFERON Tuberculin Skin Test (1890s) QuantiFERON-TB (2000s) 2-4 visits required Single visit, results in <24 hours Subjective, low specificity: 65.9% Objective, high specificity: 99.2% Not reliable for TB-vaccinated people Can rule out use of BCG vaccine Proven clinical and workflow
Slide 20: QuantiFERON
QuantiFERON Opportunity 2016 developments QuantiFERON: “Pre-molecular” technology 2016 goal: >$140 million of QuantiFERON-TB sales Lead $1 billion latent TB test market conversion Ongoing conversion from tuberculin skin test (TST) Attractive menu expansion options Support from new TB gui
Slide 21: Next-generation sequencing
Next-generation sequencing Applied Academia Pharma Testing Molecular Diagnostics GeneReader NGS System Universal NGS Single-cell genomics Whole exome Clinical research Hereditary diseases Gene expression Whole genome Translational medicine Infectious diseases Targeted resequencing
Slide 22: Next-generation sequencing
Next-generation sequencing Ease of use Reliable results Unique automation Data interpretation QIAcube® GeneRead QIAcube® GeneReaderTM Bioinformatics portfolio NGS SAMPLE PREPARATION ALIGNMENT / PRIMARY ANALYSIS / SAMPLE NGS RUN TARGET LIBRARY CLONAL INTERPRETATION / TECH ENRICHMENT PREP AMPLIFICATIO
Slide 23: Key benefits of GeneReader NGS System
Next-generation sequencing Key benefits of GeneReader NGS System 1. First complete NGS workflow 2. Actionable insights Seamless integration Reports linked to proven gene panel Single vendor for full solution Highest-quality bioinformatics platform 3. High flexibility 4. Guaranteed results 5.
Slide 24: Next-generation sequencing: Digital NGS
Next-generation sequencing QIAseq Traditional Feature “Digital NGS” approaches “Digital NGS” with QIAseq Higher sensitivity and Proprietary “Digital NGS” leverages higher specificity Molecular Index technology for use Accurate detection of in universal NGS assay panels even very rare variants Ke
Slide 25: Next-generation sequencing
Next-generation sequencing Opportunity 2016 developments Increasing demand for universal NGS solutions 2016 target: >$100 m of universal NGS solution sales Shape emergence of oncology benchtop sequencing GeneReader NGS System: >$200 m market with dynamic potential 2016 target: ~55-60 pla
Slide 26: Personalized Healthcare
Personalized Healthcare Selected partners QIAGEN: CDx partner of choice No. 1 in PCR-based companion diagnostics FDA approvals: KRAS and EGFR Selected key success factors Broadest platform range (PCR / NGS / Modaplex) Linking content and interpretation Independence Regulatory and reimb
Slide 27: Personalized Healthcare
Personalized Healthcare Opportunity 2016 developments Precision medicine changing cancer treatment Milestone: >16 master collaboration agreements in 2016 Scientific advances: New tests and technologies Two new collaborations Daiichi Sankyo – new extensive collaboration Confidential partn
Slide 28: QIAsymphony
QIAsymphony 2016 goal: Breaking through >1,750 installed systems Molecular Diagnostics Applied Testing Academia / Pharma Healthcare-acquired infections Forensics / Human ID Translational medicine Women’s health Veterinary medicine Gene panels / Food safety Biomarker testing Transplan
Slide 29: QIAsymphony
QIAsymphony Opportunity 2016 developments Medium-throughput testing: >$750 m market On track for >1,750 cumulative placements in 2016 Customer demand for robust automation systems Front-end use with GeneReader NGS System Modular components for different applications Workflow automation o
Slide 30: Differentiated Technologies: Liquid biopsy
Differentiated Technologies Liquid biopsy Technology focus areas Circulating Exosomes Free circulating tumor cells nucleic acids ~$200 million (DNA) (DNA / RNA) (DNA / RNA) opportunity Most comprehensive liquid biopsy portfolio Concept first published in a 1947 scientific article Non-invasive al
Slide 31: Differentiated Technologies: Liquid biopsy sample technologies
Differentiated Technologies QIAamp QIAsymphony Free circulating nucleic acids exoRNAeasy Exosomes QIAcube REPLI-g and AdnaGen Circulating tumor cells (CTCs) Setting the standards for liquid biopsy sample technologies Sample to Insight Investor presentation Q4 2016 31
Slide 32: Differentiated Technologies: Microbiome
Differentiated Technologies Microbiome Technology focus areas Extraction from complex No bias in NGS Turning micro- metagenomic samples library preparation biome data into insights Inhibitor removal from samples ~$100 million opportunity QIAGEN microbiome workflows Microbiomes first recognized in
Slide 33: Differentiated Technologies: Single-cell research
Differentiated Technologies Single-cell research Technology focus areas 20% Immunology 40% Cancer 10% Neuroscience 10% Stem cell ~$150 million opportunity 20% Other QIAscout – Single-cell isolation for every lab Focus on unique cell populations over time Analyzing heterogeneous cellular activity
Slide 34: Differentiated Technologies
Differentiated Technologies Opportunity 2016 developments Improving Life Sciences funding trends Developing Sample to Insight workflows: Demands for workflow solutions – not technologies Liquid biopsy Digital NGS Microbiomes Trends Epigenetics Cycle of scientific breakthroughs gainin
Slide 35: Bioinformatics
Bioinformatics QIAGEN QIAGEN Core capabilities Life Sciences portfolio Clinical portfolio Microbial Pro Suite IVA Microbial RNA-Seq HGMD Microbial Epigenetics Algorithm development RNA-Seq Explorer QCI-Analyze Services IPA QCI-Interpret Knowledge base Genomics Workbench curation Biomedical Workbench
Slide 36: Bioinformatics
Bioinformatics 100% hardware Software + Integration 100% software ATGCA T ACGT Hardware drives technology Appreciation for hardware Software drives technology adoption, with software in a and software roles to create adoption with focus on secondary role fully integrated solutions universal solution
Slide 37: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q3 2016 results Appendix Sample to Insight Investor presentation Q4 2016 37
Slide 38: 2015: Quarterly and full-year results overview
2015: Quarterly and full-year results overview In $ millions Q1 2015 Q2 2015 Q3 2015 Q4 2015 Full-year (Except EPS) 2015 Adjusted net sales 298.7 319.5 314.6 348.5 1,281.2 Adjusted gross profit 218.1 225.7 222.3 246.0 912.0 Adjusted gross profit margin 73% 71% 71% 71% 71% Adjusted operating income 6
Slide 39: Full-year 2015: Adjusted net sales and EPS
Full-year 2015: Adjusted net sales and EPS 2015 adjusted net sales development 2015 adjusted diluted EPS development (In $ billions) (In $ per share) +$0.13 $1.13 CER CER -$0.08 +3% CER $1.05 $1.35 bn -5% $1.00 $1.28 bn -3 p.p. +6% CER -8% p.p. ~3% ~97% of sales of sales 2014 2015 2015 2015 FX 2015
Slide 40: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q3 2016 results Appendix Sample to Insight Investor presentation Q4 2016 40
Slide 41: QIAGEN sales trends, portfolio rejuvenation, operating expenses
QIAGEN sales trends (CER) Portfolio rejuvenation 9% (3-year CER sales CAGR of 2013 portfolio, excluding M&A) 2013 2016E 7% 6% 5% 5% 5% 24% 4% 4% ~40% 3% 3% 4% 3% 2% 2% ~60% 2% 76% Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4 Q1 Q2 Q3 <10% CER growth 2013 2013 2013 2013 2014 2014 2014 2014 2015 2015 2015 2015
Slide 42: Q3 2016: Overview
Q3 2016: Overview 1 Q3 2016: QIAGEN delivers on targets In $ millions Change (Except EPS) Q3 2016 Q3 2015 $ / (CER) +9% CER net sales in line with +8-9% CER target Net sales 338.7 314.6 +8% / (+9% CER) +10% CER sales growth from 98% of portfolio Operating income 47.0 46.2 2% excluding U.S. HPV t
Slide 43: Q3 and 9M 2016: Net sales by product type and customer class
Q3 and 9M 2016: Net sales by product type and customer class Q3 2016 net sales: 9M 2016 net sales: $338.7 million $971.5 million Sales % CER % of Sales % CER % of (In $ m) change sales (In $ m) change sales Consumables and related revenues $298 +9% 88% $852 +6% 88% Instruments $41 +3% 12% $120 +4% 1
Slide 44: Q3 2016: Key developments
Q3 2016: Key developments Differentiated Technologies QuantiFERON-TB Next-Generation Sequencing QIAseq cfDNA All-in-One launched: Final USPSTF guidelines include Accelerating new chemistry for Workflow from plasma to NGS library QuantiFERON-TB, expand testing GeneReader after U.S. court decisi
Slide 45: Q3 2016: Selected new product launches
Q3 2016: Selected new product launches ~$150-200 m market ~$220 m market ~$100 m market in oncology benchtop NGS in commercial bioinformatics in single-cell research GeneReader Bioinformatics Single-cell NGS System solutions research QIAsymphony SP integration Hereditary disease solution QIAscout in
Slide 46: 2016: Quarterly and YTD income statement summary
2016: Quarterly and YTD income statement summary (In $ millions, unless indicated) (Diluted EPS in $ per share) Q1 2016 Q2 2016 Q3 2016 Q4 2016 YTD 2016 Net sales 298.4 334.4 338.7 971.5 Net sales (CER) 305.6 338.1 341.8 985.5 Gross profit 184.7 210.9 220.8 616.5 Gross profit margin 62% 63% 65% 63%
Slide 47: Q3 2016 and 9M 2016: Reconciliation adjusted results
Q3 2016 and 9M 2016: Reconciliation adjusted results Net Gross Operating Pretax Income Tax Net Diluted (In $ millions, except EPS) sales profit income income tax rate income EPS(1) Third quarter 2016 Reported results 338.7 220.8 47.0 36.6 -2.9 8% 33.8 0.14 Adjustments Business integration and acquis
Slide 48: 9M 2016: Balance sheet and cash flow
9M 2016: Balance sheet and cash flow Balance sheet data Leverage ratio(1) (As of September 30) 2016 2015 Group liquidity (In $ millions) 464 430 3.3 Net debt (In $ millions) 608 633 Shareholder equity ratio 62% 61% 2.2 Leverage ratio(1) 1.5x 1.5x 1.6 1.5 1.3 1.1 Cash flow 0.9 0.9 (In $ millions) 9M
Slide 49: FY 2016: Adjusted net sales and adjusted EPS outlook
FY 2016: Adjusted net sales and adjusted EPS outlook As of November 2, 2016 2016: Adjusted net sales outlook 2016: Updated adjusted diluted EPS outlook (At constant exchange rates, and as percentage of sales) (In $ per share) ~$1.10-1.11 CER ~+6-7% CER $1.05 Exiqon acquisition ~$0.87- ~2 p.p. (June
Slide 50: Q4 and full-year 2016: Outlook and assumptions
Q4 and full-year 2016: Outlook and assumptions As of November 2, 2016 Q4 2016 outlook Full-year 2016 outlook Net sales ~+8% CER ~+6-7% CER ~$0.38 CER ~$1.10-1.11 CER Adjusted diluted EPS excluding restructuring charge(1) (Prior year: $0.31) (Prior year: $1.05) After-tax restructuring charge (1) (~$0
Slide 51: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q2 2016 results Appendix Sample to Insight Investor presentation Q4 2016 51
Slide 52: Global reach into the most attractive geographic markets
Global reach into the most attractive geographic markets Aarhus Manchester Hilden Venlo Redwood Waltham Germantown City Shanghai Shenzhen Hilden, Germany Europe Germantown, Maryland Americas Shanghai Asia-Pacific Sample to Insight Investor presentation Q4 2016 52
Slide 53: Employees as of September 30, 2016
Employees as of September 30, 2016 Europe / Asia Pacific / Total Total Americas Change Middle East / Africa Japan / ROW Q3 2016 Q3 2015 Production 305 595 108 1,008 987 2% R&D 203 758 49 1,010 991 2% Sales 616 716 562 1,894 1,733 9% Marketing 78 165 76 319 310 3% Admin 95 310 64 469 456 3% Total 1,2
Slide 54: Your contacts
Your contacts John Gilardi Dr. Sarah Fakih Alexandra Koenig Vice President Associate Director Coordinator Corporate Communications and IR Investor Relations Investor Relations Phone: +49 2103 29 11711 Phone: +49 2103 29 11457 Phone: +49 2103 29 11709 or +1 240 686 2222 Mobile: +49 152 018 11457 Mobi