Qiagen N.v. · NYSE:QGEN
Qiagen — Investor Presentation (March 2016)
69 slides from Qiagen's investor presentation, Mar 15, 2016
Slide 1: Investor presentation Q1 2016
Investor presentation Q1 2016 Sample to Insight
Slide 2: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 3: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results and 2016 outlook Appendix Sample to Insight Investor presentation Q1 2016 3
Slide 4: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG BUILDING BLOCKS OF LIFE AACAAGTTAA
Slide 5: Customers want molecular insights
Customers want molecular insights Faster Better More efficiently i The opportunity: Address demands for differentiated molecular testing solutions Sample to Insight Investor presentation Q1 2016 5
Slide 6: QIAGEN at a glance
QIAGEN at a glance 2015 sales ~$1.3 billion Customers >500,000 Global reach >35 countries Employees ~4,500 Share listings NASDAQ / Frankfurt Headquarters Netherlands We help customers gain insights to improve healthcare and advance science Sample to Insight Investor presentation Q1 2016 6
Slide 7: World leader in molecular testing solutions that enable valuable insights
SAMPLE TO INSIGHT SOLUTIONS Sample Technologies Assay Technologies Bioinformatics Automation systems VALUABLE BIOLOGICAL MOLECULAR SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sample to Insight Investor presentation Q1 2016 7
Slide 8: Expanding worldwide sales in established and emerging markets
Targeting high-growth markets Diversified global presence QIAGEN net sales in top 7 emerging markets 2015 adjusted net sales: $1.3 billion (In % of total QIAGEN sales) (In % of total QIAGEN sales) ~15% Europe / ~14% Middle East / ~32% ~12% Africa ~9% ~47% Americas Asia-Pacific / Japan / ~21% Rest of
Slide 9: Addressing the needs of >500,000 customers worldwide
QIAGEN sales by product group (As % of 2015 net sales: $1.3 billion) Molecular Diagnostics Consumables ~50% of sales (incl. bioinformatics) ~87% Applied Testing Pharma Life Sciences ~50% of sales ~13% Academia Instruments and automation solutions Addressing the needs of >500,000 customers worldwide
Slide 10: Building leadership across Life Sciences and Molecular Diagnostics
QIAGEN sales by customer class (As % of annual net sales) $1.3 bn $1.3 bn $1.2 bn 23% 22% Academia $1.0 bn 26% Life Sciences 26% 19% 20% Pharma 20% 8% 9% Applied Testing 21% 7% 3% U.S. HPV 16% 6% 20% 22% Molecular 46% Rest of portfolio Diagnostics 34% 27% 25% 2009 2011 2013 2015 MDx portfolio Applie
Slide 11: One core focus: Sample to Insight in molecular testing solutions
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other PCR Technologies NGS Assay QuantiFERON Other Software and Biox biological content TB / Immune Infectious Human ID / Pharma Life
Slide 12: Following a clear strategic development plan
1984 – 2000 2000 – 2004 2004 – 2013 >2014 COMPONENTS AUTOMATION WORKFLOWS SAMPLE TO INSIGHT SOLUTIONS Offer individual Automate individual Develop integrated Create hyper-connected technologies workflow steps automated workflows and high-utility solutions with full test menu Following a clear strate
Slide 13: Transforming QIAGEN to leadership in Molecular Diagnostics and Life Sciences
Molecular Applied Adjusted net sales overview: 2011-2015 Diagnostics Testing Pharma Academia In $ billions, as percentage of sales QIAsymphony $1.3 bn $1.3 bn Personalized $1.2 bn Healthcare (PHC) ~25% ~33% ~18% QuantiFERON-TB Bioinformatics ~67% ~65% ~64% GeneReader NGS System QIAseq universal solu
Slide 14: Making a difference in the most attractive areas
Making a difference in the most attractive areas of molecular diagnostics and life sciences Pioneer in liquid biopsy sample technologies Sample to Insight Investor presentation Q1 2016 14
Slide 15: Targeting $1 billion TB testing opportunity
Targeting $1 billion TB testing opportunity Sample to Insight Investor presentation Q1 2016 15
Slide 16: Accelerating NGS adoption in clinical healthcare
Accelerating NGS adoption in clinical healthcare Sample to Insight Investor presentation Q1 2016 16
Slide 17: Leading partner to pharma for companion diagnostics
Leading partner to pharma for companion diagnostics that help guide treatment decisions Sample to Insight Investor presentation Q1 2016 17
Slide 18: Automation to drive molecular testing dissemination
Automation to drive molecular testing dissemination Sample to Insight Investor presentation Q1 2016 18
Slide 19: Breakthroughs giving access to the excitement of science
Breakthroughs giving access to the excitement of science Sample to Insight Investor presentation Q1 2016 19
Slide 20: Leveraging the potential of QIAGEN's Sample to Insight portfolio
Sample Technologies QuantiFERON-TB GeneReader NGS System QIAseq universal solutions Personalized Healthcare (PHC) QIAsymphony Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight Investor presentation Q1 2016 20
Slide 21: Sample Technologies: Most trusted brand
Sample Technologies: Most trusted brand QIAGEN: #1 in Sample Technologies Needs QIAGEN offering Dedicated solutions for Differentiated and automated challenging samples types Sample Technology portfolio Highest level of quality Industry leader for liquid to extract biological targets biopsy
Slide 22: QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis
QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis Latent TB testing total addressable market: $1 bn Needs QIAGEN offering Tuberculosis (TB) still a More than 7 million tests major global health burden delivered in 2015 Addressing latent TB critical New gold standard, repla
Slide 23: NGS: Driving dissemination into routine clinical use
NGS: Driving dissemination into routine clinical use ~80% of all NGS runs conducted on samples processed with QIAGEN Needs QIAGEN offering NGS workflows still hampered GeneReader: by many bottlenecks First complete Sample to Insight NGS solution Systems tailored for the clinical community >8
Slide 24: Personalized Healthcare: Pioneer in companion diagnostics
Personalized Healthcare: Pioneer in companion diagnostics Record number of 15 master collaboration agreements Needs QIAGEN offering Avoid “trial-and-error” 4 FDA approved tests medicine First CE-IVD liquid biopsy Improve treatment CDx for Iressa in lung cancer outcomes for patients Broades
Slide 25: QIAsymphony: Driving molecular testing dissemination
QIAsymphony: Driving molecular testing dissemination 2016 target: >1,750 installed systems Needs QIAGEN offering Flexible sample processing Continuous loading for highest level of flexibility Standardized workflow to ensure quality and safety Efficient and reliable sample preparation Compr
Slide 26: Bioinformatics: Best in-class data analysis and interpretation
Bioinformatics: Best in-class data analysis and interpretation Expected output of NGS data in 2015: 1.5 billion DVDs Needs QIAGEN offering NGS drives sharp increase in Global market leader in output of raw biological data commercial bioinformatics Emerging clinical >420,000 samples analyzed
Slide 27: Disciplined capital allocation
DISCIPLINED CAPITAL ALLOCATION Reinvest for organic growth Increase returns Targeted M&A / licensing Strengthen our premium > $500 m returned to Continuing our strategy Sample to Insight portfolio shareholders (2013-2015) Novel technologies Repurchases of shares Molecular test content an
Slide 28: Summary
Summary Expanding leadership in Sample to Insight solutions Leading positions in the most exciting areas of molecular diagnostics and life sciences Delivering growth during transformation 2016: Moving into a faster growth phase Sample to Insight Investor presentation Q1 2016 28
Slide 29: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results and 2016 outlook Appendix Sample to Insight Investor presentation Q1 2016 29
Slide 30: Leveraging the potential of QIAGEN's Sample to Insight portfolio
Sample Technologies QuantiFERON-TB GeneReader NGS System QIAseq universal solutions Personalized Healthcare (PHC) QIAsymphony Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight Investor presentation Q1 2016 30
Slide 31: Sample Technologies
Sample Technologies Free circulating nucleic acids RNA and DNA from dead cells shed into the bloodstream, can contain cancer- related mutations. Exosomes Tiny microvesicles found in body fluids that transport RNA between cells. Circulating tumor cells Tumor cells shed from a tumor into the bloodstre
Slide 32: Sample Technologies
Sample Technologies QIAamp QIAsymphony Free circulating nucleic acids exoRNAeasy Exosomes QIAcube REPLI-g and AdnaGen Circulating tumor cells (CTCs) Setting the standards for liquid biopsy sample technologies Sample to Insight Investor presentation Q1 2016 32
Slide 33: Sample Technologies: Strengthening differentiated portfolio
Sample Technologies Strengthening our differentiated Sample Technology portfolio MO BIO: late 2015 acquisition Microbiome: fast growing area in research and clinical Challenge: extremely complex samples (skin, feces, soil, waste water, etc.) Patented Inhibitor Removal Technology® Complemen
Slide 34: QuantiFERON-TB
QuantiFERON-TB Latent tuberculosis infection (LTBI) Latent tuberculosis test target groups Public health TB control 1 in 3 people Employment Medical staff worldwide… screening Fire and police exposed to TB Congregated Correctional sites will develop latent TB living Military Universities
Slide 35: QuantiFERON-TB
QuantiFERON-TB Tuberculin Skin Test (1890s) QuantiFERON-TB (2000s) 2-4 visits required Single visit, results in <24 hours Subjective, low specificity: 65.9% Objective, high specificity: 99.2% Not reliable for TB-vaccinated people Can rule out use of BCG vaccine Proven clinical and workfl
Slide 36: QuantiFERON-TB
QuantiFERON-TB 1st generation 2nd generation 3rd generation 4th generation QuantiFERON®-TB Gold QuantiFERON®-TB Gold QuantiFERON®-TB QuantiFERON®-TB (liquid antigen) (QFT® in tube) Gold PLUS 2001: FDA approval 2004: FDA approval 2007: FDA approval 2015: CE-IVD rollout 2016: FDA submission Introducin
Slide 37: Next-generation sequencing
Next-generation sequencing Ease of use Reliable results Unique automation Data interpretation QIAcube® GeneRead QIAcube® GeneReaderTM Bioinformatics portfolio NGS SAMPLE PREPARATION ALIGNMENT / PRIMARY ANALYSIS / SAMPLE NGS RUN TARGET LIBRARY CLONAL INTERPRETATION / TECH ENRICHMENT PREP AMPLIFICATIO
Slide 38: Key benefits of GeneReader NGS System
Next-generation sequencing Key benefits of GeneReader NGS System 1. First complete NGS workflow 2. Actionable insights Seamless integration Reports linked to proven gene panel Single vendor for full solution Highest-quality bioinformatics platform 3. High flexibility 4. Guaranteed results 5.
Slide 39: Next-generation sequencing
Next-generation sequencing GeneReader NGS System development Expand range of sample types Liquid biopsy, fresh and frozen tissue A T GCA Broaden test content T ACG T Expand oncology panels / other applications Improve technology performance Chemistry and other system upgrades 2016 focus on Gen
Slide 40: Personalized Healthcare
Personalized Healthcare Selected partners QIAGEN: CDx partner of choice No. 1 in PCR-based companion diagnostics FDA approvals: KRAS and EGFR Selected key success factors Broadest platform range (PCR / NGS / Modaplex) Linking content and interpretation Independence Regulatory and reimb
Slide 41: Personalized Healthcare
Personalized Healthcare Selected co-development projects Project Partner Indication Biomarkers Status Iressa Lung cancer 2015: U.S. FDA approval EGFR (gefitinib) (NSCLC) 2014: First-ever liquid biopsy CE-IVD (galeterone) Prostate cancer EGFR 2015: Liquid biopsy CDx project Various Various Various Ma
Slide 42: QIAsymphony
QIAsymphony 2016 goal: Breaking through >1,750 installed systems Molecular Diagnostics Applied Testing Academia / Pharma Healthcare-acquired infections Forensics / Human ID Translational medicine Women’s health Veterinary medicine Gene panels / Food safety Biomarker testing Transplan
Slide 43: QIAsymphony
QIAsymphony Selected tests in current portfolio Selected potential submissions HIV-1 Blood-borne Virus HBV HCV KRAS JAK2 WT1 JAK2 NRAS Personalized EGFR BCR-ABL PML-RARA BCR-ABL ALK Healthcare BRAF IDH1/2 Others CALR Others CT/NG T vaginalis Women’s Health
Slide 44: QIAsymphony in-house tests
QIAsymphony In-house tests BBV TPx HAI WH ESBL/CRE HSV1/2 CT/NG MRSA VanR C.diff CMV Trich GBS HCV HBV HPV EBV BKV VZV QIAGEN QIAsymphony HIV * * * * Roche instruments Abbott instruments Siemens instruments QIAsymphony RGQ Roche: Different platforms Abbott: Different platforms Siemens platform No so
Slide 45: Bioinformatics
Bioinformatics 40 ~80% out of the 40 top Pharma companies rely on QIAGEN bioinformatics solutions of all NGS runs enabled by QIAGEN >30,000 ~250 publications referencing QIAGEN bioinformatics products for >14 sample preparation validated GeneRead V2.0 panels >420,000 sequenced samples uploaded into
Slide 46: Bioinformatics
Bioinformatics Value shift in next-generation sequencing Rapid rise in sequencing data Billions of bases 100% Equal to 1.5 billion DVDs 1,000,000,000 1,000,000 50% 1,000 1 0 0% ~2000 ~2010 ~2020 1982 1987 1991 1995 1999 2003 2007 2011 2015 Experiment design Source: Yale University Source: Cisco Syst
Slide 47: Bioinformatics
Bioinformatics Seamlessly integrated solutions across NGS workflow Alignment to Disease and biological models Clinical trials, reference drugs, guidelines genome Manually Analysis and curated scientific Pathway visualization literature and network diagrams Workflow CLC bio Ingenuity / BIOBASE Sample
Slide 48: Bioinformatics
Bioinformatics Preparation Sequencing Analysis Interpretation CLC Ingenuity Discovery RNA-Seq Genomic Pathway Workbench Analysis CLC Ingenuity Discovery DNA-Seq Genomic Variant Workbench Analysis Ingenuity BIOLOGICAL CLC Cancer VALUABLE Translational DNA-Seq Variant SAMPLE Workbench MOLECULAR Analys
Slide 49: Bioinformatics
Bioinformatics QIAGEN Clinical Insight launch in 2015 Fully integrated, web-based workflow Allows scaling of NGS test service offerings Comprehensive and rapid annotation, classification and reporting of variants Somatic and hereditary cancer tests at start Built for full regulatory and da
Slide 50: Bioinformatics
Bioinformatics Industry-leading RNA sequencing portfolio Technology boost for single-cell sequencing Launch of 170 new QIAseq Targeted Co-marketing and co-development collaboration RNA Panels in February with 10X Genomics since February Content expansion incorporates knowledge from Linked-Re
Slide 51: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results and 2016 outlook Appendix Sample to Insight Investor presentation Q1 2016 51
Slide 52: Full-year 2015: Adjusted net sales and EPS
Full-year 2015: Adjusted net sales and EPS 2015 adjusted net sales development 2015 adjusted diluted EPS development (In $ billions) (In $ per share) +$0.13 $1.13 CER CER -$0.08 +3% CER $1.05 $1.35 bn -5% $1.00 $1.28 bn -3 p.p. +6% CER -8% p.p. ~3% ~97% of sales of sales 2014 2015 2015 2015 FX 2015
Slide 53: Full-year 2015: Income statement summary
Full-year 2015: Income statement summary In $ millions (Unless indicated) 2015 2014 Change Net sales 1,281.0 1,344.8 -5% Adjusted net sales 1,281.2 1,346.2 -5% Adjusted net sales (CER) 1,388.8 1,346.2 3% Gross profit 826.4 864.9 -4% Adjusted gross profit 912.0 954.9 -4% Adjusted gross profit margin
Slide 54: Full-year 2015: Reconciliation adjusted results
Full-year 2015: Reconciliation adjusted results In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 1,281.0 826.4 175.7 132.5 -5.6 4% 127.1 0.54 Adjustments Business integration 0.3 1.1 15.1 15.1 -4.6 10.5 0.04
Slide 55: Full-year 2015: Adjusted net sales by customer classes
Full-year 2015: Adjusted net sales by customer classes FY 2015 adjusted net sales: $1,281.2 million Consumables and related revenues +3% CER / ~87% of sales Instruments +5% CER / ~13% of sales MDx portfolio excl. HPV +7% CER +1% CER ~46% of sales Molecular Diagnostics ~49% of sales U.S. HPV -43% CER
Slide 56: 2015: Geographic regions and product portfolio
2015: Geographic regions and product portfolio Full-year 2015 geographic region sales Full-year 2015 product portfolio sales Consumables and Europe / Middle East / Africa related revenues +6% CER +3% CER ~32% of sales ~87% of sales Instruments +5% CER Asia-Pacific / Japan ~13% of sales +7% CER Ameri
Slide 57: Full-year 2015: Currency impact
Full-year 2015: Currency impact Full-year 2015 Adjusted net sales Adjusted net sales Currency exposure Change (In $ millions) (CER) (As % of CER sales) (In $ millions) U.S. dollar 540.3 540.3 39% 0.0 Euro 299.1 357.2 26% -58.1 British pound 96.5 103.8 7% -7.3 Japanese yen 45.1 51.6 4% -6.5 Other cur
Slide 58: Full-year 2015: Balance sheet and cash flow
Full-year 2015: Balance sheet and cash flow As of December 31 2015 2014 Free cash flow trends Group liquidity (In $ millions) 421 577 (In $ millions) Net debt (In $ millions) 642 601 $220 m Shareholder equity ratio 61% 60% $201 m Net debt / adjusted EBITDA ratio(1) 1.6x 1.3x $175 m Cash flow (In $ m
Slide 59: 2016: Adjusted net sales growth perspectives
2016: Adjusted net sales growth perspectives 2016 adjusted net sales outlook 2016 adjusted diluted EPS outlook (At constant exchange rates, and as percentage of sales) (In $ per share) ~+6% CER ~$1.10-1.11 CER ~+6% CER $1.05 MO BIO ~1 p.p. acquisition (late 2015) +3% CER Enzymatics ~5 p.p. acquisiti
Slide 60: Q1 and full-year 2016: Outlook and assumptions
Q1 and full-year 2016: Outlook and assumptions Q1 2016 outlook Full-year 2016 outlook Adjusted net sales(1) ~+2% CER ~+6% CER ~$0.19-0.20 CER ~$1.10-1.11 CER Adjusted diluted EPS(2) (Prior year: $0.22) (Prior year: $1.05) Amortization of acquired intellectual property (In $ millions) ~30 ~120 Busine
Slide 61: Q4 2015: Income statement summary
Q4 2015: Income statement summary In $ millions (Unless indicated) Q4 2015 Q4 2014 Change Net sales 348.5 360.4 -3% Adjusted net sales 348.5 360.8 -3% Adjusted net sales (CER) 372.6 360.8 3% Gross profit 223.3 215.8 3% Adjusted gross profit 246.0 244.2 1% Adjusted gross profit margin 71% 68% Operati
Slide 62: Q4 2015: Reconciliation adjusted results
Q4 2015: Reconciliation adjusted results In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 348.5 223.3 54.4 46.5 1.9 -4% 48.6 0.20 Adjustments Business integration 2.9 6.0 6.0 -1.9 4.1 0.02 and acquisition-rel
Slide 63: Q4 2015: Adjusted net sales by customer classes
Q4 2015: Adjusted net sales by customer classes Q4 2015 adjusted net sales: $348.5 million Consumables and related revenues +5% CER / ~86% of sales Instruments -4% CER / ~14% of sales MDx portfolio excl. HPV +2% CER +0% CER ~46% of sales Molecular Diagnostics ~49% of sales U.S. HPV -14% CER ~3% of s
Slide 64: Q4 2015: Currency impact
Q4 2015: Currency impact Q4 2015 Adjusted net sales Adjusted net sales Currency exposure Change (In $ millions) (CER) (As % of CER sales) (In $ millions) U.S. dollar 135.4 135.4 36% 0.0 Euro 83.2 94.9 25% -11.7 British pound 29.6 30.9 8% -1.3 Japanese yen 11.4 12.1 3% -0.7 Other currencies 88.9 99.3
Slide 65: 2015: Quarterly and full-year results overview
2015: Quarterly and full-year results overview In $ millions Q1 2015 Q2 2015 Q3 2015 Q4 2015 Full-year (Except EPS) 2015 Adjusted net sales 298.7 319.5 314.6 348.5 1,281.2 Adjusted gross profit 218.1 225.7 222.3 246.0 912.0 Adjusted gross profit margin 73% 71% 71% 71% 71% Adjusted operating income 6
Slide 66: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results and 2016 outlook Appendix Sample to Insight Investor presentation Q1 2016 66
Slide 67: Global reach into the most attractive geographic markets
Global reach into the most attractive geographic markets Aarhus Manchester Venlo Hilden Hombrechtikon Stockach Redwood Waltham Germantown City Shanghai Shenzhen Hilden, Germany Europe Germantown, Maryland Shanghai Americas Asia-Pacific Sample to Insight Investor presentation Q1 2016 67
Slide 68: Employees as of December 31, 2015
Employees as of December 31, 2015 Europe / Total Total Asia Pacific / Americas Middle East / Change Japan / ROW Q4 2015 Q4 2014 Africa Production 268 626 106 1,000 940 6% R&D 235 685 99 1,019 951 7% Sales 622 634 506 1,762 1,688 4% Marketing 79 164 71 314 309 2% Admin 106 294 64 464 451 3% Total 1,3
Slide 69: Your contacts
Your contacts John Gilardi Dr. Sarah Fakih Alexandra Koenig Vice President Senior Manager Coordinator Corporate Communications and IR Investor Relations Investor Relations Phone: +49 2103 29 11711 Phone: +49 2103 29 11457 Phone: +49 2103 29 11709 or +1 240 686 2222 Mobile: +49 152 018 11457 Mobile: