Nestle S.a. · SIX:NESN
Nestle — Tecan Symposium 2010
53 slides from Nestle's conference presentation, 2010
Slide 1: R&D in Nestlé: Innovating the Future in Nutrition, Health and Wellness
R&D in Nestlé Innovating the Future in Nutrition, Health and Wellness A short introduction of the context
Slide 2: Nestlé, the World’s Largest Food Company
Nestlé, the World’s Largest Food Company Pharmaceutical Nestlé products Nutrition Powd. & Liq. PetCare 7% 9% beverages 12% 18% Confectionery 11% Nestlé Waters Prep. Dishes & 8% Cooking aids Milk products & Ice Cream 16% 18% Sales of CHF 108 billion in 2009 280‘000 employees 93% of sales is food and
Slide 3: Nestlé Science & Research Locations
Nestlé Science & Research Locations St. Louis (US) Lausanne (CH) Beijing (CN) Tokyo (JP) Staff of 700 including over 300 scientists from 50 2005 2006 2007 2008 2009 nationalities Scientific Publications 213 237 260 221 210 Connecting to the scientific community: from inventors to Patent Applicat
Slide 4: The Nestlé Research Network
The Nestlé Research Network 2010 York Welwyn Garden City / CPW Singen Fremont Minneapolis Amiens Lisieux Konolfingen Solon Beauvais Nestlé Professional Bev.Centre Orbe Marysville Tours Orbe Bakersfield Vittel Broc St. Joseph Tokyo NRC Lausanne NRC St. Louis+ NRC Beijing + NRC Queretaro Sderot Shangh
Slide 5: NRC Collaborations with Leading Universities
NRC Collaborations with Leading Universities The Broad Institute of MIT and Harvard: Inflammation Ecole Polytechnique Fédérale de Lausanne: Cognition Imperial College London: Metabonomics L’Institut National de la Recherche Agronomique: Nutrition The University of Tokyo (TODAI): Healthy aging McMast
Slide 6: Nutrition, Health & Wellness - NRC Research Activities and Departments
Nutrition, Health & Wellness - NRC Research Activities and Departments Structure Taste Bioavailability Ingredients Texture Flavor Disposition Safety Aroma Health effects Biomarkers Satiety Appetite Inter-individual differences Food Food/Consumer Scientific & Nutrition Petcare Basic Science Interacti
Slide 7: Bacterial genomics for probiotics
Bacterial genomics for probiotics Bernard Berger Food and Health Microbiology Nestlé Research Center, Lausanne Tecan Symposium 2010, Salzburg
Slide 8: Food fermentation - History
Food fermentation - History • 7000 B.C. Milk in sheep stomach poach/rennet Euphrat/Tigris • 6000-3000 B.C. Coagulated sour milk – Dahi, Laban India, Egypt • 6000 B.C. Winemaking Near East, Greece • 3500 B.C. Breadmaking Egypt • 3200-1200 B.C. Cheese – Soft, pickled Egypt, Greece • 2000 B.C. Yogurt
Slide 9: Probiotic - Definition
Probiotic - Definition Live microorganisms which when administered in adequate amounts confer a health benefit on the host WHO/FAO expert group, 2001 9
Slide 10: One Century of Probiotic Concept
One Century of Probiotic Concept 1907 2009 Elie Metchnikoff 700 Publications (1845-1916) 600 Patents Number of documents with the term "probiotic*" in the title or abstract 500 400 300 200 100 0 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005
Slide 11: Intestinal microbiota: We are not alone!
Intestinal microbiota We are not alone! Stomach 101 - 103 cfu / g Duodenum Jejunum / Ileum 104 - 108 cfu / g Colon 1010 - 1012 cfu / g Intestinal tract Human body ~1013 ~1014 cells Bacteria of > 500 different species B. Berger - NRC
Slide 12: Interaction with the intestinal mucosa
Interaction with the intestinal mucosa Pathogens Pathogens Pathogens Commensals Pathogen MUCOSAL SITES ? exclusion Probiotics DC sIgA sIgA M cell Peyer’s patches SYSTEMIC IgG + IgA SITES Lymphocyte Mesenteric lymph node Blood Modified from Ken Beauchamp J. Clin. Invest. B. Berger - NRC
Slide 13: Probiotic Strains
Probiotic Strains Examples of Some Commercially Available Probiotic Strains Species Strain Source Bifidobacterium lactis BB-12 Chr. Hansen, Inc. (Milwaukee, WI, USA) B longum BB536 Morinaga Milk Industry Co., Ltd. (Zama-City, Japan) B longum SBT-2928 Snow Brand Milk Products Co, Ltd. (Tokyo, Japan)
Slide 14: Exploiting gut bacterial genomes
Exploiting gut bacterial genomes Schell et al 2002, PNAS Pridmore et al 2004, PNAS B. Berger - NRC
Slide 15: Bifidobacterium longum NCC2705 genome sequence
Bifidobacterium longum NCC2705 genome sequence • 2,256,638 bp circular chromosome • 1781 predicted ORFs • 1180 (67%) with at least partial function assigned • 601 (33%) with no functional characteristics • ~ 10% are variable within the species • Scarce genetic toolbox • Not a "model organism" 15
Slide 16: Key steps in Probiotic Developments
Key steps in Probiotic Developments Discovery Technological Scientific Product Quality Safety Efficacy Screening properties Dossier Launch Control Mechanisms ? 16
Slide 17: Key steps in Probiotic Developments: Example 1
Key steps in Probiotic Developments Example 1: In silico screening of probiotic genomes Discovery Technological Scientific Product Quality Safety Efficacy Screening properties Dossier Launch Control Mechanisms ? 17
Slide 18: In silico screening of probiotic genomes
In silico screening of probiotic genomes List of Database of undesired undesirable keywords genes Public sequences databases DUG db Characterization of the ingredient Genome Sequence In silico Scientific Safety quality safety sequencing evaluation dossier verification screening Strain wet lab descri
Slide 19: Key steps in Probiotic Developments: Example 2
Key steps in Probiotic Developments Discovery Technological Scientific Product Quality Safety Efficacy Screening properties Dossier Launch Control Mechanisms ? Example 2: Gut persistence of Lactobacillus johnsonii NCC533 19
Slide 20: Comparative analysis of persistence in the GIT
Comparative analysis of persistence in the GIT A (NCC533): EryR B: CmR Intra-gastric gavage of strains A & B (109 cfu/day) in conventional mice D1 D2 D3 Fecal counts 20
Slide 21: Persistence in the GIT
Persistence in the GIT 8 A B 7 Log10 cfu/ g feces 6 5 - 7days 4 0 1 2 4 5 6 8 10 12 14 16 Time (days) 21
Slide 22: What is the genetic base for the difference in persistence?
What is the genetic base for the difference in persistence? Hypothesis: The genetic factors explaining the difference in persistence between strain A and B must be: • Strain specific • Expressed in the GIT 22
Slide 23: Comparative genomics with DNA arrays
Comparative genomics with DNA arrays Genome A Genome B DNA arrays 240 1580 ? 240 genes present in the genome of strain A are absent in the genome of strain B 23
Slide 24: Gene expression in mice GIT
Gene expression in mice GIT Genome A RNA extraction from jejunum Axenic mice colonised with strain A 175 genes of strain A are expressed in the jejunum 24
Slide 25: The fusion of both microarray data sets
The fusion of both microarray data sets Genes present in strain A only Genes expressed Lactobacillus in jejunum johnsonii NCC533 6 genes specific for strain A, corresponding to three genetic loci, were transcribed in bacteria associated with the jejunal mucosa Product/function LJ1021-LJ1035 EP
Slide 26: Comparative analysis of persistence in the GIT
Comparative analysis of persistence in the GIT A: EryR A KO-mutant: CmR Intra-gastric gavage of WT & mutant (109 cfu/day) in conventional mice D1 D2 D3 Fecal counts B. Berger - NRC
Slide 27: Mutant PTS Mannose KO vs WT
Mutant PTS Mannose KO vs WT 8 WT PTS mutant 7 Log10 cfu / g feces 6 5 - 6 days 4 0 2 4 6 8 10 12 14 16 18 Time (days) B. Berger - NRC
Slide 28: WT vs IgAse mutant
WT vs IgAse mutant 8 WT IgAse mutant 7 Log10 cfu / g feces 6 5 - 4 days 4 0 2 4 6 8 10 12 14 16 18 Time (days) B. Berger - NRC
Slide 29: WT vs EPS mutant
WT vs EPS mutant 8 WT EPS mutant 7 Log10 cfu / g feces 6 5 + 2 days 4 0 2 4 6 8 10 12 14 16 18 Time (days) B. Berger - NRC
Slide 30: WT vs EPS mutant
WT vs EPS mutant B. Berger - NRC
Slide 31: Strategy to narrow down complexity of omics data
Strategy to narrow down complexity of omics data • Combination of transcriptomics and comparative genomics • Concept was confirmed using 3 knock- out mutants Denou et al 2007, J. Bact Denou et al 2008, J. Bact 31
Slide 32: Key steps in Probiotic Developments: Example 3
Key steps in Probiotic Developments Example 3: Natural Selection and Molecular Characterization of Bifidobacterium longum Heat- Shock Tolerant Mutants Discovery Technological Scientific Product Quality Safety Efficacy Screening properties Dossier Launch Control Mechanisms ? 32
Slide 33: Many key factors to master: Probiotic Stability
Many key factors to master Probiotic Stability Probiotic incorporation into food FACTORS INFLUENCING STABILITY FERMENTATION pH Harvesting time Media & feeding strategy Atmosphere Sub-lethal stress (post fermentation) Fermentation Spray drying & addition to Growth in Addition to Dry products: DOWNSTR
Slide 34: Heat-shock response in B. longum NCC2705
Heat-shock response in B. longum NCC2705 HS at 7 min, 50°C clpB clgR 44 hsp20 dnaK operon 33 ECF-sigma hrcA groES groEL htrA 22 cspA lexA fold change (log2) 11 More expressed 00 -1 -1 Less expressed clpX clpC -2 -2 -3 -3 -4 -4 8 9 10 11 12 13 14 15 A_7' intensity Rezzonico et al. 2007 FEMS Microbiol
Slide 35: Cyclic selection of naturally occurring Heat-Shock tolerant mutants
Cyclic selection of naturally occurring Heat-Shock tolerant mutants shock shock Heat-shock stress non-selective … O/N growth HS tolerance of the NCC2705 derivatives, 13 min at 59°C 7 6 5 log loss 4 3 2 1 0 wt Mut1 Mut2 NCC2705 35
Slide 36: Global transcriptomic analysis of the Heat-Shock tolerant mutants
Global transcriptomic analysis of the Heat- Shock tolerant mutants Mut1 / wt 5 Mut2 / wt 5 BL0516 4 BL0516 dnaK 4 BL0517 BL0519 BL0517 BL0520 3 BL0519 BL0520 operon 3 BL1250 2 2 fold change (log2) BL1250 fold change (log2) 1 clpB 1 0 before HS 0 -1 -1 -2 -2 -3 -3 -4 -4 -5 -5 4 6 8 10 12 14 6 8 10 12
Slide 37: Comparison of the two independent HS-tolerant mutants
Comparison of the two independent HS-tolerant mutants Kup system potassium uptake 4 dnaK operon ABC transporters 3 fold change (Mut1 / wt) clpB 2 aromatic a.a. ribonucleoside- 1 aminotransferase diphosphate reductase operon 0 endo- xylanase -1 clpB flanking unknown -2 unknown ABC transporter -3 fim
Slide 38: A potential dnaK-clpB regulon
A potential dnaK-clpB regulon Heat Heat - HAIR HAIR dnaK grpE dnaJ hspR - HAIR clpB c/o Str. coelicolor (Bucca et al., 1997, 2000, 2003) B. Berger - NRC
Slide 39: HspR, the dnaK-clpB regulator, is mutated in potential DNA-binding motifs
HspR, the dnaK-clpB regulator, is mutated in potential DNA-binding motifs HTH W1 W2 N C Mut1 Mut2 ACTCTCCGTCAGTACGACCGCCTC GGCGCACGCCGCTACTGCCTGCGC T L R Q Y D R L G A R R Y C L R ACTCTCCGTCAGCACGACCGCCTC GGCGCACGCCGCTGCTGCCTGCGC T L R Q H D R L G A R R C C L R HTH : helix-turn-helix; W : winged hel
Slide 40: Strategy to narrow down complexity of omics data
Strategy to narrow down complexity of omics data • Isolate mutant strains showing define phenotype (by natural cyclic selection) • Global comparison of mutants with wt strain to observe genetic differences (transcriptomic) • Compare independent mutants amongst them to identified common genetic modif
Slide 41: Survival after Spray-Drying and Low Moisture Storage
Survival after Spray-Drying and Low Moisture Storage A B C 7 6 5 4 Log loss spray-drying 3 2 weeks 3 weeks 2 Storage 4 weeks 37°C 8 weeks 1 Aw 0.22 12 weeks 0 wt wt wt Mut2 Mut2 Mut2 B. Berger - NRC
Slide 42: Key steps in Probiotic Developments: Example 4
Key steps in Probiotic Developments Example 4: Molecular identification and tracing of probiotic strain Discovery Technological Scientific Product Quality Safety Efficacy Screening properties Dossier Launch Control Mechanisms ? 42
Slide 43: Why do we need to identify and trace probiotics at strain level?
Why do we need to identify and trace probiotics at strain level ? • Effect of probiotic on the host are strain-specific • Characterization of the probiotic strain (as ingredient) required by EFSA (European Food Safety Authorities) • In clinical trial, need to associate the beneficial effect to the p
Slide 44: Insertion sequence (IS element)
Insertion sequence (IS element) 1 - 2.5 Kb DNA sequence 1 or 2 genes for transposition Inverted Repeat Inverted Repeat 10-80 bp 10-80 bp Insertion sequences are mobile elements: random selection of insertion site p. 44
Slide 45: Insertion Sequences and genomes
Insertion Sequences and genomes • Insertion sites of IS elements are characteristic for a genome Strain A Strain B … Strain X IS elements : differences p. 45
Slide 46: How to map IS elements by PCR on a genome
How to map IS elements by PCR on a genome IS element A B PCR amplification Gel eletrophoresis M - + Ref: Klijn 2005 (review) p. 46
Slide 47: IS mapping and Strain-specific PCR probes for NCC4010
IS mapping and Strain-specific PCR probes for NCC4010 PCR primer pairs pUniv strains 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 2496 N N N N N N N N N N N N P N N N N N N Y N N C 2798 N N N N N N N N N N N N N N N N N N N N N N C Y= 2802 N N N N N N N N N N N N N N N Y N N N N N N C pr
Slide 48: The CRISPRs
The CRISPRs CRISPRs = Clustered Regularly Interspaced Short Palindrome Repeats unique spacers (30-40 bp) of extrachromosomal origin repeats of 30-40 bp Leader sequence • CRISPRs evolve by acquisition of DNA sequences from phages and provide, together with cas genes, resistance against phages • Hypot
Slide 49: The CRISPRs and their evolution
The CRISPRs and their evolution • Three rules for CRISPRs evolution : – Addition of motifs is polarized and requires that the last constant region near the leader is duplicated L L addition – Random deletions or duplications of spacers and repeats may occur L L deletion – The presence of identical s
Slide 50: Diversity of the CRISPRs in St. thermophilus
Diversity of the CRISPRs in St. thermophilus Barrangou 2007 B. Berger - Nestlé Research Center p. 50
Slide 51: St. thermophilus NCC2496
St. thermophilus NCC2496 • Sequencing with 454 FLX/Roche • Three CRISPRs clearly annotated in the closely related St. thermophilus LMD-9 strain. – CRISPRs1 : two additional spacers in NCC2496 – CRISPRs2 : small, no difference between LMD-9 and NCC2496 – CRISPRs3 : one additional spacer in NCC2496 NC
Slide 52: Overall conclusions
Overall conclusions IS element A B IS element PCR amplification A B 4 t) 3 PCR amplification Gel eletrophoresis w / M - + t1 2 u (M 1 Gel eletrophoresis e0 g n M - + a h-1 c d l -2 o f -3 -3 -2 -1 0 1 2 3 4 fold change (Mut2 / wt) Discovery Technological Scientific Product Quality Safety Efficacy Sc
Slide 53: Acknowledgements
Database of Undesirable Genes • Magda Fisseha Gut-Persistence • Caroline Barretto • Emmanuel Denou • Catherine N'gom-Bru • Raymond David Pridmore • Fabrizio Arigoni • Bernard Berger • Jean-Michel Panoff (UCBN) • Fabrizio Arigoni Tracing by IS elements • Harald Brüssow • Bernard Berger • Deborah Moin