Precision Biosciences, Inc. · NASDAQ:DTIL
Precision Biosciences — Investor Presentation (June 2019)
32 slides from Precision Biosciences's investor presentation, Jun 7, 2019
Slide 1: Precision BioSciences: Dedicated to Improving Life
Exhibit 99.1 BIOSCIENCES < PRECISION Dedicated to Improving Life. Cure genetic disease. Feed the planet.
Slide 2: Forward-looking statements
This presentation (together with any other statements or information that we may make in connection herewith) may contain forward-looking statements. All statements other than statements of present and historical facts contained in this prospectus, including without limitation, statements regarding
Slide 3: Dedicated To Improving Life
Dedicated To Improving Life Overcome Cancer. Cure Genetic Disease. Feed the Planet.
Slide 4: Delivering on the Promise of Genome Editing
Delivering on the Promise of Genome Editing Proprietary ARCUS genome editing platform built for translation with full freedom to operate Fully scaled and cell-optimized allogeneic CAR T platform in the clinic for R/R NHL and ALL Industry leading in vivo gene correction platform first to publish in n
Slide 5: Our Near-Term Development Strategy
Our Near-Term Development Strategy Indication: Hepatitis B Target: cccDNA and integrated DNA IND 2020 Indication: NHL and ALL Target: CD19 (PBCAR091) Clinical Phase I Indication: NHL, CLL, SLL Target: CD20 (PBCAR20A) Clinic 2019 Product: Ultra-low sat canola oil Target: Saturate pathways Greenhouse
Slide 6: Nature's Genome Editing System ARCUS
Nature’s Genome Editing System ARCUS
Slide 7: Our Objective: Therapeutic-Grade Genome Editing
Our Objective: Therapeutic-Grade Genome Editing Industry’s Approach to Genome Editing Ease of design Speed of manufacture Density of targeting Open source Precision BioSciences' Approach to Genome Editing Safety Delivery Control of edits Proprietary ü ü ü ü
Slide 8: ARCUS: Engineering Nature's Genome Editing System
ARCUS: Engineering Nature’s Genome Editing System ARCUS is derived from I-CreI, a homing endonuclease naturally evolved for highly precise genome editing Safety: Requires productive binding before cutting Delivery: Small size (364 amino acids) maximizes delivery Control of edit: “Sticky ends” enable
Slide 9: Overcoming Cancer: Off-the-shelf CAR T
Overcoming Cancer Off-the-shelf CAR T
Slide 10: Off-the-shelf CAR T Immunotherapy Pipeline
Off-the-shelf CAR T Immunotherapy Pipeline Product Candidates Program Area Discovery Pre-clinical Clinical Rights PBCAR0191 (CD19) PBCAR20A (CD20) PBCAR269A (BCMA) PBCAR371A (CLL-1) NHL and ALL - Ph1/2a initiated Q2 2019, Interim Data Q1 2020 CLL, SLL, and NHL - Clinic 2019 MM - IND 2020 AML - IND 2
Slide 11: An Allogeneic CAR T Platform Designed to Overcome Cancer
An Allogenic CAR T Platform Designed to Overcome Cancer Allogeneic CAR T requires a traditional drug development approach to compete with traditional biologics Single-step cell engineering Proprietary process optimization Yield Quality Cost Highly consistent product Available on demand Minimize comp
Slide 12: Proprietary Single Step CAR T
Precision BioSciences’ Proprietary Single Step CAR T Reduces heterogeneity in cell formulation Streamlines manufacturing Claimed in 9 issued US patents Single-Step CAR T T cell Receptor Alpha Constant (TRAC) locus Exon 1 Exon 2 Exon 3 Exon 4 T Cell
Slide 13: Scaled CAR T Manufacturing: Optimizes Yield and Quality
Scaled CAR T Manufacturing: Optimizes Yield and Quality Final Yield CD19 Drug Product (64M CAR T cells/vial) CD3- >99% CAR+ 65% - 75% TN/SCM & TCM >50% 1.25 CD4:1 CD8 (Batch2) Batch Vial Count 1 130 2 114 3 100 cold storage -1 0 3 8 10 Activation Expansion 1 Expansion 2 Cell Number Ship Receive Harv
Slide 14: Donor selection and manufacturing maximize naive and central memory T cells
Donor selection and proprietary manufacturing designed to maximize naive and central memory T cells Rapid in vivo expansion is correlated with high proportions of combined Naïve (TN/SCM) and Central Memory (TCM) CD4+ and CD8+ T cells. We believe that this is critical to the success of an allogeneic
Slide 15: Roadmap for Clinical Development
Maximization of naïve and central memory T cells allows for initial exploration with standard cy/flu LD Clinical data will direct an expanded LD or the addition of a biologic only if needed The “Stealth Cell” vector will be explored upon completion of initial clinical studies *Novel cell masking str
Slide 16: Stealth Cell: B2M Knockdown to Extend Cell Persistence
“Stealth Cell” “Stealth Cell” B2M B2M B2M Expression (normalized mean MFI) B2M Expression (normalized mean MFI) % CAR T Cell Lysis % CAR T Cell Lysis Rejection by T Cells Rejection by NK Cells “Stealth Cell” B2M Knockdown to Extend Cell Persistence Completely eliminating MHC-I (knocking out B2M) res
Slide 17: PBCAR0191: Phase 1/2a Clinical Plan
Objectives Primary: safety and tolerability Secondary: anti-tumor activity Exploratory: expansion, trafficking, and persistence Dose Escalation DL1 = 3.0 x 105/kg (~ 1.8 – 2.5 x 107 total cells) n=3 DL2 = 1.0 x 106/kg (~ 6.0 – 8.5 x 107 total cells) n=3 DL3 = 3.0 x 106/kg (~ 1.8 – 2.5 x 108 total ce
Slide 18: First Allogeneic cGMP Manufacturing Facility in the U.S.
First Allogeneic cGMP Manufacturing Facility in the U.S. 17,300 square foot cGMP clinical manufacturing expected to open in 2H 2019 Allogeneic CAR T Cells, mRNA (10g scale) and rAAV (400L scale) vectors for in-vivo and ex-vivo uses Facility in close proximity to RDU airport and Precision R&D facilit
Slide 19: Curing Genetic Disease: In Vivo Gene Correction
Curing Genetic Disease In Vivo Gene Correction
Slide 20: In Vivo Gene Correction Pipeline
Product Candidate Program Area Discovery Pre-clinical Clinical Rights HBV Transthyretin HAO1 FVIII (Intron 22 inversion) P23H RHO ApoC3 PCSK9 Familial amyloid polyneuropathy Chronic Hepatitis B – IND 2020 Primary hyperoxaluria Hemophilia A Retinitis pigmentosa Lipoprotein lipase deficiency Familial
Slide 21: In Vivo Gene Correction Strategy
In Vivo Gene Correction Strategy Difficulty of Edit Difficulty of Delivery Initial focus is primarily on gene deletions in the liver and eye In vivo gene corrections are complicated by the type of edit and the need to deliver efficiently to specific tissues More technically challenging edits and oth
Slide 22: Hepatitis B: Targeted Elimination of Virus DNA
Hepatitis B: Targeted Elimination of Virus DNA ARCUS can target and destroy HBV cccDNA to potentially cure chronic HBV Development of a potential cure A) ARCUS reduces HBV S-antigen in infected human hepatocytes Untreated HBsAg (% untreated control) cccDNA ARCUS We are working with Gilead to develop
Slide 23: Rhesus macaques show sustained reductions in PCSK9 and LDL
Rhesus macaques treated with ARCUS show sustained reductions in PCSK9 and LDL levels since 2017 First peer-reviewed data demonstrating in vivo gene correction in a non-human primate model LDL levels are stably reduced by roughly 50% or more following one-time AAV delivery of an ARCUS nuclease Animal
Slide 24: Autosomal Dominant Retinitis Pigmentosa: Restore Vision
Autosomal Dominant Retinitis Pigmentosa: Restore Vision ARCUS can be used to selectively eliminate the P23H RHO gene associated with adRP ARCUS treatment restores vision in a humanized pig model of P23H adRP >RHO C68A (P23H) mutant ACGGGTGTGGTACGCAGCCACT >wild-type rhodopsin ACGGGTGTGGTACGCAGCCCCT l
Slide 25: Feed the Planet: Elo Life Systems
Feed the Planet Elo Life Systems
Slide 26: Food Pipeline
Product Discovery Greenhouse Field Program Lead Ultra-low Saturate Canola Oil Scaled, Zero Calorie Watermelon Sweetener Self-Breeding Stevia High Protein Chickpea Food Pipeline
Slide 27: Elo Seeks to Improve Human Health Through Food
Elo Seeks to Improve Human Health Through Food Climate change is already having a dramatic impact on our food supply Consumers are increasingly demanding healthier, sustainable sources of food Elo has fully integrated ARCUS with key enabling and discovery technologies Developed successful partner-dr
Slide 28: Ultra-Low Saturate Canola Oil with Cargill
Source: US patent 2017/0034541 W; TSFA: C18:0/C20:0/C22:0/C24:0; TSFA = Total Saturated Fatty Acid Ultra-Low Saturate Canola Oil Fatty Acid Biosynthesis Pathway in Canola Cargill is one of the world’s largest producers of cooking oil. We are collaborating with Cargill to develop ultra-low saturate “
Slide 29: Mogroside V: Scaled Zero Calorie Sweetener
Mogroside V: Scaled Zero Calorie Sweetener Mogroside V is an all-natural zero calorie sweetener from Monk Fruit + ARCUS Mogroside V pathway activity Scalable ü û û ü ü ü Mogroside V is difficult to source because monk fruit is not scalable Grown regionally, long life cycle, small, difficult to culti
Slide 30: Cash Runway Takes Us Into 2021
Cash Runway Takes Us Into 2021 Initial Public Offering (Ticker: DTIL) - Q2 2019 ü Clinical dosing of allogenic CD19 CAR T - Q2 2019 Open cGMP manufacturing facility: mRNA, AAV, CAR T - 2H 2019 Wholly-owned CD20 CAR T enters clinic Q4 2019 Interim data from P1 CD19 CAR T - Q1 2020 IND for lead in viv
Slide 31: Key Takeaways
Key Takeaways Highly experienced team of over 160 Precisioneers includes the pioneers in editing Proprietary ARCUS genome editing platform with full freedom to operate Independent cGMP manufacturing capabilities by YE 2019 Multiple CAR T programs will be in human clinical trials by YE 2019 Strong ba
Slide 32: Precision BioSciences
PRECISION BIOSCIENCES rc ria Y aul Overcome Cancer. Feed the Planet. Dedicated To Improving Life
Precision BioSciences — Investor Presentation (June 2019) on 6ix