Prime Medicine, Inc. · NASDAQ:PRME
Prime Medicine — Corporate Update (August 2023)
32 slides from Prime Medicine's corporate update, Aug 7, 2023
Slide 1: Prime Medicine August 2023
prime_ medicine Prime Medicine August 2023
Slide 2: Forward-looking statements
2 This presentation contains forward-looking statements of Prime Medicine, Inc. (“Prime”, “we” or “our”) within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements contain information about our current and future prospects and our operations and fina
Slide 3: Prime Medicine brings together the right people and technology
3 Prime Medicine brings together the right people and the right technology at the right time with the aim to deliver the promise of one-time, curative genetic therapies to address the widest spectrum of diseases. 30 years after the first patient was treated with gene therapy, gene editing is only ju
Slide 4: Prime Editing stands out as a best-in-class genetic medicine approach
5 Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete Performs and corrects insertions, de
Slide 5: Prime Medicine is well-positioned to maximize Prime Editing's therapeutic potential
6 Prime Medicine is well-positioned to maximize Prime Editing’s broad therapeutic potential In ~2.5 years since company inception: Built and advanced a strategic portfolio Identified and progressed initial pipeline of 18 programs • Focusing on indications with the fastest, most direct path to demons
Slide 6: Our current portfolio of programs leverages versatility of Prime Editing
7 Our current portfolio of 18 programs leverages the versatility and breadth of Prime Editing Initially focused on our first two strategic indication categories in diseases where Prime Editing could offer compelling advantages over current standard-of-care and novel therapeutic modalities in develop
Slide 7: Prime Edited CGD patient cells produce p47phox protein and NADPH oxidase activity
81234 clones analyzed; 2Normalized to healthy donor controls; 3Myeloid cells produced from CD34+ cells were analyzed by flow cytometry for detection of myeloid markers including CD13 (percentage of cells expressing CD13 is depicted); 4 Oxidization of dihydrorhodamine (DHR) to fluorescent rhodamine b
Slide 8: Maintenance of >92% corrected long-term HSCs following engraftment
9 Maintenance of >92% corrected long-term HSCs following 16-week engraftment Successful Prime Editing in long-term HSC population: in vivo engraftment of Prime Edited CD34+ Cells NBSGW: NOD.Cg-KitW41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ highly immunodeficient mice that support human CD34+ cell engraft
Slide 9: Long-term study shows ~90% LT-HSC correction
10 Long-term study with cells from single donor (Donor 2) shows ~90% LT-HSC correction (similar to Donor 1 results on previous slide)1 Successful Prime Editing in long-term HSC population: Prime Editing is highly reproducible 1Long-term engraftment is 16-weeks after CD34+ cell infusion. 2Data for do
Slide 10: No significant difference between mock and Prime Edited LT-HSC
11 No significant difference between mock and Prime Edited LT-HSC in hematopoietic reconstitution Successful Prime Editing: 16-week engrafted Prime Edited long-term HSCs support multilineage blood production, biodistribution in vivo No significant difference between Mock and PE groups. Statistical a
Slide 11: Prime Editing removes GAA repeats and hyper-methylation at FXN gene
12 High efficiency Prime Editing removes the GAA pathological repeats and hyper-methylation at the Frataxin (FXN) gene in Friedreich’s Ataxia patient cells Successful Prime Editing removal of pathogenic repeats: Friedreich’s ataxia Demethylation by Prime Editing restores mRNA transcription of FXN Hy
Slide 12: Prime Editing restores FXN protein expression and sensory neuron function
13 FXN: Frataxin; FRDA: Friedreich's Ataxia; iDRG: iPSC-derived dorsal root ganglia. DAPI: nuclear staining; βIII-TUB: axonal projection staining High efficiency Prime Editing restores FXN protein expression and sensory neuron function in Friedreich’s Ataxia patients’ dorsal root ganglia Successful
Slide 13: Non-viral delivery to intestinal organoids restores CFTR function
14 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients wi
Slide 14: Safety: suite of assays for off-target discovery
15 Safety: Prime’s comprehensive suite of assays for off- target discovery* On-target Off-targetPE2 PE2 genome GGCCCAGACTGAGCACGTGA GGCCCAG-CTGAGCTCGTGA Targeted Sequencing (>1000x) potential off-target editing sites Identified Off-targets Genome wide Nick Detection Assay** Genome wide DSB detection
Slide 15: Safety: minimal or no off-target editing
16 Safety: Preliminary off-target analyses demonstrate minimal or no off-target editing Data expands the demonstration of no off-target editing detected across multiple prime edited cell types On-target (NCF1) Targeted Sequencing Genome wide and targeted detection of potential off- targets potential
Slide 16: Safety: No large deletions or translocations in Prime Edited LT-HSCs
17 Safety: No large deletions or translocations detected in Prime Edited LT-HSCs Off-Target Data from analysis of total human material from mouse bone marrow harvested 16 weeks after engraftment dPCR: CD34+ population was sorted and expanded in colony forming media, individual colonies were picked a
Slide 17: LNP Delivery: mRNA optimization increases Prime Editing efficiency
18 LNP Delivery: Optimization of mRNA increases Prime Editing efficiency and leads to reduction of PCSK9 protein in serum Prime Editor LNP delivered systemically • Prime Editor mRNA • Prime Eeditor guide RNA Optimized mRNA increases Prime Editing in whole liver Day 0 Day 7 Optimized mRNA decreases P
Slide 18: Dual AAV delivery achieves high efficiency in mouse brain
191Three weeks in neonatal mice via intra-cerebral infusion (ICV); 5 weeks in adult mice via local administration into cerebellum or cortex. 2Prime Editor cassette with neuron-specific promoter. All experiments shown are Proof of Concept delivery experiments using a control Prime Editor site. Prime
Slide 19: Prime Medicine has rapidly advanced and improved Prime Editing
20 Prime Medicine has rapidly advanced and substantially improved Prime Editing Engineered pegRNAs4 • Improved pegRNA stability • Up to 4-fold increase in editing Novel PE Proteins • 80+ active RT domains • RT domains up to 60% smaller • Up to 2-fold increase in editing pegRNA Enhancements • New cla
Slide 20: Prime Medicine holds foundational IP for Prime Editing
21 Patent portfolio includes: • U.S. Patent 11,447,770, covering methods of using Prime Editors • U.S. Patent 11,643,652, covering composition of matter for Prime editor guide RNAs (PEgRNAs) • U.S. allowed application 17/751,599, covering Prime Editing systems that include PEgRNA, Prime Editor prote
Slide 21: PASSIGE: inserting gene sized sequences precisely in the genome
22 PASSIGETM: Applying Prime Editing to insert gene sized sequences precisely in the genome Prime Assisted Site-Specific Integrase Gene Editing Prime Editing Site-specific recombination DNA donor Recombinase enzyme Precise target location in genomic DNA Genomic DNA Programmed insertion of recombinas
Slide 22: PASSIGE and multiplex Prime Editing for allogeneic CAR-T
23 Model of Multiplex Edited CAR-T CAR: chimeric antigen receptor; TRAC: T-cell receptor alpha constant; PASSIGE: Prime-Assisted Site-Specific Integrase Gene Editing PASSIGE and multiplex Prime Editing approach for allogeneic off-the-shelf CAR-T cell product Supports potential for Prime Editing to b
Slide 23: PASSIGE: Efficient insertion of anti-CD19 CAR at TRAC locus
24PASSIGE: Prime-Assisted Site-Specific Integrase Gene Editing; n = 2 technical replicates ; Far right panel: n = 4 technical replicates; Two-way ANOVA with Bonferroni post-test *** P = 0.0002; **** P < 0.0001 Data presented at ASGCT 26th Annual Meeting, May 2023. PASSIGE: Efficient insertion of ant
Slide 24: PASSIGE: B2M knockout and reduced tumor burden in vivo
25Data presented at ASGCT 26th Annual Meeting, May 2023. PASSIGE: Knockout of B2M can be achieved in 95% of Prime-Edited T cells and PASSIGE CAR-T cells reduce tumor burden in vivo Knockout with Prime Editing is efficient in T cells and can be done in multiplex PASSIGE Prime Editing technologies can
Slide 25: Business Development and Partnering: A major focus for 2023
26PE = Prime Editing Business Development and Partnering: A major focus for 2023 We aim to maximize PE’s broad therapeutic potential and create value by: Independently developing and commercializing in appropriate disease areas (our pipeline) Entering strategic collaborations to extend the reach and
Slide 26: Prime Medicine and Cimeio research collaboration
27 HSC = Hematopoietic Stem Cell; AML/MDS = Acute Myeloid Leukemia/Myelodysplastic Syndrome; SCIP = Shielded Cell and Immunotherapy Pairs Prime Medicine and Cimeio: Research collaboration to enable best-in-class HSC medicines Goal: Reduce toxicity of conditioning regimens and introduce new therapeut
Slide 27: Prime can multiplex to combine shielding with therapeutic edits
28 Prime can multiplex to combine shielding with therapeutic edits Patient HSCs Carrying Pathogenic Mutation Edited HSCs Carrying Corrected Gene and CD117 Shielding Edit Prime Editing to make a single amino acid substitution at epitope required for antibody binding Target of Shielding Edit Shielding
Slide 28: Building the Company
29 Currently • ~200 employees; approximately 85% across Research & Technical Development • Key leadership and staff across all departments of the organization in place • Built out core capabilities across the company, from IP strategy to automation and AI to RNA technologies • Established strong ext
Slide 29: Summary of ongoing activities and next steps
30 Summary of select ongoing activities and next steps for Prime Medicine Key upcoming events will continue to drive the Prime Medicine platform forward Pipeline Nominated first Development Candidate for Chronic Granulomatous Disease (CGD) in 1Q 2023. • Initiate investigational new drug (IND)-enab
Slide 30: Backup
31 Backup
Slide 31: Non-viral delivery to intestinal organoids restores CFTR function
32 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients wi
Slide 32: Non-viral delivery to intestinal organoids restores CFTR function
33 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients wi