Prime Medicine, Inc. · NASDAQ:PRME
Prime Medicine — 41st Annual J.P. Morgan Healthcare Conference 2023
22 slides from Prime Medicine's conference presentation, Jan 9, 2023
Slide 1: Prime Medicine at the 41st Annual J.P. Morgan Healthcare Conference
Exhibit 99.1 Prime Medicine st 41 Annual J.P. Morgan Healthcare Conference January 2023 1
Slide 2: Forward-Looking Statements
Forward-Looking Statements This presentation contains forward-looking statements of Prime Medicine, Inc. (“Prime”, “we” or “our”) within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements contain information about our current and future prospects an
Slide 3: Now is the moment for a revolution in gene editing
30 years after the first patient was treated with gene therapy, gene editing is only just beginning to demonstrate clinical benefit. Now is the moment for a revolution. Prime Medicine brings together the right people and the right technology at the right time with the aim to deliver the promise of o
Slide 4: Prime Editing stands out as a best-in-class genetic medicine approach
Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete ✓ Performs and corrects insertions, dele
Slide 5: Prime Editing stands out as a best-in-class genetic medicine approach
Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete ✓ Performs and corrects insertions, dele
Slide 6: Prime Medicine is well-positioned to maximize Prime Editing's therapeutic potential
Prime Medicine is well-positioned to maximize Prime Editing’s broad therapeutic potential In ~2.5 years since company inception: Identified and progressed initial pipeline of 18 programs • Focusing on indications with the fastest, most direct path to demonstrating technological success, as well as d
Slide 7: Our current portfolio of programs leverages the versatility of Prime Editing
Our current portfolio of 18 programs leverages the versatility and breadth of Prime Editing To be discussed in detail today STRATEGIC TARGET INDICATION DELIVERY DISCOVERY* IND-ENABLING CLINICAL TRIALS CATEGORY TISSUE Sickle Cell Disease ex vivo BLOOD Chronic Granulomatous Disease ex vivo Fanconi Ane
Slide 8: Ex-Vivo HSC: Prime Editing in long-term HSC population in CGD mouse model
Ex-Vivo HSC Successful Prime Editing in long-term HSC population: in vivo engraftment in Chronic Granulomatous Disease mouse model Maintenance of >92% corrected long-term HSCs following 16-week engraftment + + Prime Editor Naive CD34 Edited CD34 NBSGW mice Cryopreserve/Thaw 0hr 24hr 0 weeks 16 weeks
Slide 9: Prime Editing removal of pathogenic repeats: Friedreich's ataxia
Methylation (%) Repeat Expansion Diseases Successful Prime Editing removal of pathogenic repeats: Friedreich’s ataxia High efficiency Prime Editing removes the GAA pathological repeats and hyper-methylation at the Frataxin Dual-flap correction of FXN in FRDA iPSCs (FXN) gene in Friedreich’s Ataxia p
Slide 10: Prime Editing restores FXN protein expression and sensory neuron function
Repeat Expansion Diseases Successful Prime Editing removal of pathogenic repeats High efficiency Prime Editing restores FXN protein expression and sensory neuron function in Friedreich’s Ataxia patients’ dorsal root ganglia Restoration of axonal βIII-TUB projections after prime editing Restoration o
Slide 11: Unmet needs in Cystic Fibrosis: restoring CFTR function in G542X patients
Unmet need in CF Unmet needs in Cystic Fibrosis: Restoring CFTR function in patients with G542X mutation One-time, non-viral delivery to patient intestinal organoids restores CFTR function Optimization results in high efficiency Prime Prime Editing of patient intestinal organoids Editors that precis
Slide 12: Off-Target Safety: comprehensive suite of assays for off-target discovery
Off-Target Safety: Prime’s comprehensive suite of assays for off- target discovery* GGCCCAG-CTGAGCTCGTGA Local off-targets Chromosome scale or structural off-targets Off-target PE2 GGCCCAGACTGAGCACGTGA Translocations PE2 cDNA synthesis genome On-target Large Deletions Reverse Trans. Assay Chromosoma
Slide 13: Off-Target Safety: preliminary analyses show minimal or no off-target editing
Off-Target Safety: Preliminary off-target analyses demonstrate minimal or no off-target editing Data expands the demonstration of no off-target editing detected across multiple prime edited cell types Wilsons Disease 1 CGD Program: CD34+ Cells Genome wide and 2 Program: Hepatocytes targeted detectio
Slide 14: LNP Delivery: optimized mRNA increases Prime Editing efficiency
LNP Delivery LNP Delivery: Optimization of mRNA increases Prime Editing efficiency and leads to reduction of PCSK9 protein in serum Prime Editor LNP delivered to the liver a precisely introduced stop codon in PCSK9 gene in mice Prime Editor LNP delivered systemically • Prime Editor mRNA • Prime edit
Slide 15: Dual AAV Delivery: CSF and local administration to CNS
Dual AAV Delivery Prime Editing Delivery: CSF and Local Administration to CNS via dual AAV achieves high efficiency in mouse brain 2 Dual AAV effectively delivers to ~ 95%, and precisely edits ~80%, of neurons in adult mice Prime Editor dual AAV • Prime Editor • Prime editor dual guide RNA 1 0 weeks
Slide 16: Prime Medicine has rapidly advanced and improved Prime Editing
Prime Medicine has rapidly advanced and substantially improved Prime Editing • Prime Medicine holds foundational IP and has filed for IP protection for technological advancements • Patent portfolio includes U.S. Patent 11,447,770 covering methods of using Prime Editors, and US allowed application 17
Slide 17: PASSIGE: Prime Assisted Site-Specific Integrase Gene Editing
PASSIGE Prime Assisted Site-Specific Integrase Gene Editing PASSIGE: Applying Prime Editing to insert gene sized sequences precisely in the genome Programmed insertion of Integration of Precise target recombinase location in DNA at precise DNA target genomic DNA location sequence Site-specific Prime
Slide 18: PASSIGE: gene-sized sequence insertion into human primary T cells
PASSIGE PASSIGE: Efficient insertion of gene-sized sequence into a single targeted genomic site in human primary T cells PASSIGE one-step non-viral approach for precise introduction of gene sized cargo into the genome Single targeted genomic locus Prime Editing to insert recombinase …. attachment si
Slide 19: Business Development and Partnering: A major focus for 2023
Business Development Business Development and Partnering: A major focus for 2023 We aim to maximize PE’s broad therapeutic potential and create value by: 1 2 3 Entering strategic collaborations Independently developing and Partnering and licensing to to extend the reach and commercializing in approp
Slide 20: Building the Company
Building the Company Currently • 184+ employees; approximately 85% across Research & Technical Development • Key leadership and staff across all departments of the organization in place • Built out core capabilities across the company, from IP strategy to automation and AI to RNA technologies • Esta
Slide 21: Key upcoming events will continue to drive the platform forward
Key upcoming events will continue to drive the Prime Medicine platform forward Summary of select ongoing activities and next steps for Prime Medicine • Nominate first Development Candidate for Chronic Granulomatous Disease (CGD) in 1Q 2023. • Initiate investigational new drug (IND)-enabling studies
Slide 22: Prime Medicine January 2023
Prime Medicine January 2023 22
Prime Medicine — 41st Annual J.P. Morgan Healthcare Conference 2023 on 6ix