Praxis Precision Medicines, Inc. · NASDAQ:PRAX
Praxis Precision Medicines — Technical Presentation (June 2023)
25 slides from Praxis Precision Medicines's technical presentation, Jun 7, 2023
Slide 1: Leveraging Preclinical Models To Inform Clinical Trial Strategy in SCN2A DEE
Leveraging Preclinical Models To Inform Clinical Trial Strategy in SCN2A Developmental and Epileptic Encephalopathy Oligonucleotides for CNS June 7, 2023
Slide 2: Disclosures
Disclosures Disclosure Kris Kahlig is a current employee of Praxis Precision Medicines and is a Praxis stockholder. 2
Slide 3: Developing Treatments Inspired By The Genetics of Epilepsy
Developing Treatments Inspired By The Genetics of Epilepsy ENABLED BY TWO PLATFORMS CEREBRUM™ SOLIDUS™ SMALL MOLECULE PLATFORM ANTISENSE OLIGONUCLEOTIDE (ASO) PLATFORM Ulixacaltamide (PRAX-944) PRAX-090 PRAX-222 PRAX-020 PRAX-562 PRAX-030 PRAX-080 PRAX-100 PRAX-628 PRAX-050 Cerebrum™ utilizes deep u
Slide 4: Genetics of Epilepsy
Genetics of Epilepsy • Selection of an appropriate target for ASO modulation SCN2A-DEE • Model for evaluating therapeutic intervention • Model for variant characterization 4
Slide 5: Current Anti-Seizure Medications (ASMs) Employ Small Molecules
Current Anti-Seizure Medications (ASMs) Employ Small Molecules • Current therapeutics build upon recognized targets and achieve incremental gains • Small molecules and polypharmacy currently the mainstay ASMs • New approaches needed for the 30% of patients that are resistant to current therapeutic o
Slide 6: DEEs are Caused by Genetic Variation
Developmental and Epileptic Encephalopathies (DEEs) are Caused by Genetic Variation Targets • DEEs now know to be rare, often catastrophic diseases • Advances in genetics providing mechanistic understanding and new targets for DEEs McTague et al, Lancet Neurol (2015) • Oligonucleotides represent nov
Slide 7: Insights from Rare DEEs will Inform on More Common Epilepsies
Insights from Rare DEEs will Inform on More Common Epilepsies • Advances in treating rare monogenetic epilepsy will impact treatment of common forms of epilepsies • Genetics of epilepsy • Revealed novel targets • Refocused efforts on validated targets Continuum of Rare and Common Epilepsies SCN2A Ch
Slide 8: SCN2A-DEE
Genetics of Epilepsy • Selection of an appropriate target for ASO modulation SCN2A-DEE • Model for evaluating therapeutic intervention • Model for variant characterization 8
Slide 9: Variants in SCN2A are a Common Cause of Genetic Disease
Variants in SCN2A are a Common Cause of Genetic Disease • SCN2A encodes Nav1.2 • Dominantly expressed in the cortical excitatory neurons • Localized in the proximal AIS • Commonly associated with neurological and psychiatric disorders S. J. Sanders et al., Trends Neurosci. 41, 442–456 (2018). 9
Slide 10: Epilepsy variants in SCN2A can increase NaV1.2 Activity
Epilepsy variants in SCN2A can increase NaV1.2 Activity Early Onset DEE Variant R1882Q Causes NaV1.2 GoF Including Persistent INa Persistent INa is a common feature of NaV1.2 Gain of Function (GoF) Other forms of GoF also observed G. Berecki et al., Proceedings of the National Academy of Sciences. 1
Slide 11: SCN2A Pathophysiology Reflects both Gain-of-Function and Loss-of-Function
SCN2A (NaV1.2) Pathophysiology Reflects both Gain-of-Function and Loss-of-Function Onset < 3 months of age -> predicts GoF Onset > 3 months of age -> predicts LoF S. J. Sanders et al., Trends Neurosci. 41, 442–456 (2018). Potential Therapeutic Approach Potential Therapeutic Approach Selective reduct
Slide 12: Mouse Model of SCN2A-DEE: NaV1.2-R1882Q
Mouse Model of SCN2A-DEE: NaV1.2-R1882Q (Q/+) Location of Variant Premature Lethality Spontaneous Seizure Neuronal Hyperexcitability 25 # Seizures in 24 hrs 20 15 10 5 0 +/+ Q/+ The SCN2A-DEE mouse model exhibits premature lethality due to spontaneous seizure driven by neuronal hyperexcitability Li,
Slide 13: Proof of Concept Efficacy Using Mouse Directed ASO to Knockdown mRNA
Proof of Concept Efficacy Using Mouse Directed ASO to Knockdown mRNA Mouse SCN2A targeting gapmer ASO (5-10-5 MOE) GCTCATGTTACTCCTACCCT Therapeutic goal: Normalize NaV1.2 activity by reducing SCN2A mRNA Li, M. et al. J Clin Invest 131, e152079 (2021). 13
Slide 14: Mouse Scn2a ASO Selectively Reduces Scn2a Expression
Mouse Scn2a ASO Selectively Reduces Scn2a Expression Potent Knockdown of Scn2a mRNA in Mouse Cortex Selective Knockdown of Dosing at P1 Scn2a mRNA at ED80 120 S c ra m b le d 5 0 µg (1 0 3 .5 % ) 100 % P B S c o n tr o ls 80 60 40 20 0 1 10 100 D o s e (µ g ) Age @ ICV ED50 (µg) ED80 (µg) **p<0.01 P
Slide 15: Scn2a ASO Increases Survival of SCN2A-DEE mice with a Single Dose
Scn2a ASO Increases Survival of SCN2A-DEE mice with a Single Dose Potent Knockdown of Protection from Premature Scn2a mRNA in Mouse Cortex Lethality Dosing at P1 ASO injection (ICV, P1) 120 S c ra m b le d 5 0 µg (1 0 3 .5 % ) 100 100 75 **** % P B S c o n tr o ls % survival 80 50 **** 60 40 25 20 0
Slide 16: ASO Treatment Significantly Reduces Seizures and Rescues EEG Properties
ASO Treatment Significantly Reduces Seizures and Rescues EEG Properties of SCN2A-DEE mice Return of Seizures/Spikes with loss Normalization of Interictal Spikes of ASO Activity Wild Type Untreated R1882Q ASO ED50 R1882Q ASO ED80 200uV 5s Improved survival associated with reduction in Scn2a mRNA, sei
Slide 17: Administration of ASO After Disease Onset Extends Survival of SCN2A-DEE Mice
Administration of ASO After Disease Onset Extends Survival of SCN2A-DEE Mice Potent Knockdown of Scn2a mRNA in Mouse Cortex Protection from Premature Dosing at P15 Lethality 120 100 Scrambled 200 µg (96.3%) 100 %PBS controls 80 **** 75 **** % survival 60 50 40 25 20 0 0 1 10 100 0 50 100 150 200 Dos
Slide 18: Re-Dosing Significantly Extends Survival of SCN2A-DEE mice
Re-Dosing Significantly Extends Survival of SCN2A-DEE mice ~P30 P1 ICV inject Monitor survival and ICV inject Scrambled spontaneous seizure ED50 ED50 ED80 Re-Dosing Extends Survival Seizure Reappearance 50 Days Post-Dose ASO injections (ICV, P1, P28) **** 100 Average Daily Seizure / Group 2.0 75 ***
Slide 19: Model for variant characterization
Genetics of Epilepsy • Selection of an appropriate target for ASO modulation SCN2A-DEE • Model for evaluating therapeutic intervention • Model for variant characterization 19
Slide 20: SCN2A Loss of Function Variants can also Cause Seizures
SCN2A Loss of Function Variants can also Cause Seizures Onset < 3 months of age -> predicts GoF Onset > 3 months of age -> predicts LoF S. J. Sanders et al., Trends Neurosci. 41, 442–456 (2018). Assay needed to rapidly identify variants with predicted GoF features 20
Slide 21: Voltage Clamp Electrophysiology Can Predict Impact of Variant
Voltage Clamp Electrophysiology Can Predict Impact of Variant Voltage Clamp Assessment of Various Gating Parameters Variant / Phenotype Change in Voltage Clamp Predicted Effect Compared to WT on NaV1.2 Activity R853Q / Infantile Spasms ↓ Current Density LoF ↓ Window Current Decreased Activity Presen
Slide 22: Dynamic Action Potential Clamp (DAPC) Accelerates Characterization of Ion Channel Variants
Dynamic Action Potential Clamp (DAPC) Accelerates Characterization of Ion Channel Variants Assay Measures both VC (selected parameters) and DAPC from each cell NaV1.2 Variant NaV1.2 Variant 22
Slide 23: DAPC Correlates with Predictions Made from Voltage Clamp Analysis
Dynamic Action Potential Clamp Correlates with Predictions Made from Voltage Clamp Analysis DAPC VC Predicted Variant Predicted Effect Effect on on NaV1.2 Activity NaV1.2 Activity LoF Decrease in R853Q Decreased Activity Excitability GoF Increase in L1563V Increase Activity Excitability GoF Increase
Slide 24: Preclinical Models Inform Early Clinical Development of Oligonucleotides for SCN2A-DEE
Preclinical Models Inform Early Clinical Development of Oligonucleotides for SCN2A-DEE ASO modality addresses underlying genetic PRAX-222 cause of disease INTRATHECALLY-ADMINISTERED Estimating degree of target knockdown for ASO WITH POTENTIAL TO BE therapeutic response DISEASE-MODIFYING FOR EARLY ON
Slide 25: Acknowledgements
Acknowledgements • Melody Li • Kris Kahlig • Nikola Jancovski • Kelley Dalby • Snezana Maljevic • Alex Nemiroff • Geza Berecki • Steven Petrou • Lisseth Burbano Funded by Praxis Precision Medicines praxismedicines.com @PraxisMedicines Questions? kris@praxismedicines.com 25
Praxis Precision Medicines — Technical Presentation (June 2023) on 6ix