Korro Bio, Inc. · NASDAQ:KRRO
Korro Bio — J.P. Morgan Healthcare Conference 2024
36 slides from Korro Bio's conference presentation, Jan 9, 2024
Slide 1: J.P. Morgan Healthcare Conference: Edit the Message, Rewrite the Future
Exhibit 99.1 J . P . M o r g a n H e a l t h c a r e C o n f e r e n c e Edit the Message, Rewrite the Future January 2024 1
Slide 2: Disclaimers: Forward-Looking Statements
Disclaimers Forward-Looking Statements Certain statements in this Presentation may constitute “forward-looking statements”. Forward-looking statements include, but are not limited to, express or implied statements regarding expectations, hopes, beliefs, intentions or strategies of Korro Bio, Inc. (K
Slide 3: Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing
Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing Built an experienced team with a proven track record in genetic medicines TM Built an oligonucleotide-based approach (OPERA ) to affect a single base edit on RNA (efficient, specific and transient) Nominated a candi
Slide 4: Create Transformative Genetic Medicines for Diseases with High Prevalence
Create Transformative Genetic Medicines for Diseases with High Prevalence A transient and reversible way to edit RNA (A-to-I edit) using an endogenous editor Expanding the genetic medicines tool-kit by providing an “activation” approach Key internal discoveries driving the potential to develop multi
Slide 5: Causal Missense Variants Identified in Both Rare and Common Diseases
Causal Missense Variants Have Been Identified in Both Rare and Common Diseases * Need for an approach to transiently edit variants to modify biology and alleviate pathology * Adapted from Nature Volume 577, pages 179–189 (2020) 5
Slide 6: RNA Editing: Transiently Effecting an A-to-I Edit on RNA Using an Oligonucleotide
RNA Editing: Transiently Effecting an A-to-I Edit on RNA Using an Oligonucleotide Harnessing an endogenous editing enzyme, ADAR, that is ubiquitously 1 Non-viral intracellular delivery of expressed in all human cells Korro oligo designed to edit a specific adenosine on the target RNA 2 Oligo-RNA dup
Slide 7: OPERA: Our Differentiated Approach for RNA Editing
OPERA: Our Differentiated Approach for RNA Editing Deep understanding Expertise in of ADAR biology oligonucleotide chemistry Machine learning optimization Fit-for-purpose delivery of oligonucleotides 1 Comprehensive IP portfolio with 32 patent families covering Korro platform technology and editing
Slide 8: Broad and Versatile Opportunity to Impact Biology
Broad and Versatile Opportunity to Impact Biology and Potentially Bring Multiple Therapeutic Options to Patients DNA Pre-mRNA mRNA Polypeptide (Protein) TRANSCRIPTION PROCESSING TRANSLATION Edit a single A-to-I Edit a single A-to-I Current Modifying gene expression • Repair a G->A mutation to correc
Slide 9: Wholly-Owned Pipeline with Multiple High-Value Targets
Wholly-Owned Pipeline with Multiple High-Value Targets PROGRAM / PRECLINICAL WHOLLY CONCEPT DISCOVERY PHASE 1 PHASE 2 PHASE 3 INDICATION DEVELOPMENT OWNED? KRRO-110 Repairing a 1 FIH-enabling regulatory filing expected 2H’24 AAT Alpha-1 antitrypsin pathogenic variant deficiency Repairing a Parkinson
Slide 10: OPERA: Our Approach
OPERA: Our Approach KORROZ ©
Slide 11: Customized High-fidelity Oligonucleotides for RNA Deamination (CHORD)
TM Customized High-fidelity Oligonucleotides for RNA Deamination (CHORD ) Designed to have… High target efficiency CHORD High target specificity Computational efficiency Leveraging chemistry Gen 1.0: A single-stranded, anti-sense Leveraging delivery oligonucleotide RNA editor 11
Slide 12: High Efficiency: Ability to Potentially Target Any A on Any Transcript
High Efficiency: Ability to Potentially Target Any “A” of Interest on Any Transcript 1 Primary Mouse Hepatocytes Patient-derived Neuroblastoma Cells >45% editing achieved >80% editing achieved 100 100 80 80 60 60 40 40 20 20 0 0 SERPINA1 RAB7A UGP2 ACTB UGP2 ACTB RAB7A TDP43 1 SERPINA1 data is from
Slide 13: High Specificity: CHORDs Do Not Interfere with Endogenous ADAR Activity
High Specificity: CHORDs Do Not Interfere with Endogenous ADAR Activity in Preclinical Mouse Models Endogenous site: COG Endogenous site: COPA Endogenous site: AJUBA 100 100 100 80 80 80 60 60 60 40 40 40 20 20 20 0 0 0 No oligo KB-7102 KB-7657 No oligo KB-7102 KB-7657 No oligo KB-7102 KB-7657 Note:
Slide 14: Computational Efficiency: Machine Learning-Driven Identification of CHORDs
Computational Efficiency: Machine Learning-Driven Identification of CHORDs Across Targets Modification favored = New Mod Edit site Oligo models built through deep learning models 3’ 5' 5’ 3' Modification disfavored Chemically modified RNA 5’ 3’ Template oligo design 100 80 Replicated for multiple 60
Slide 15: Leveraging Chemistry: Potency Boosts In Vivo
Leveraging Chemistry: Structural Biology Insights Enable Potency Boosts In Vivo CHORD and target mRNA New chemistry introduces Significant improvement in editing complexed with ADAR improved potency in vivo in C57BL/6 mouse* 100 Day 1 Day 4 80 Potency increase with 60 new analog 40 20 0 Control KB-9
Slide 16: Leveraging Delivery: Fit-for-Purpose Based on Target Product Profile
Leveraging Delivery: Fit-for-Purpose Based on Target Product Profile GalNAc (ACTB) MC3-LNP (RAB7A) 10mg/kg (QDx5); SC administration 2mg/kg (single dose); IV administration 100 100 KB-9775 KB-2330 KB-4740 80 80 60 60 40 40 20 20 0 0 7 14 1 7 14 Days post last dose Days post last dose Note: GalNAc an
Slide 17: Alpha Anti-trypsin Deficiency (AATD): Delivering a Potential Best-in-Class Candidate
Alpha 1 Anti-trypsin Deficiency (AATD) Delivering a Potential Best-in-Class Candidate 17
Slide 18: AATD Caused by a Single Missense Mutation in SERPINA1 Gene
AATD Caused by a Single Missense (G-to-A) Mutation in SERPINA1 Gene in the Liver M-AAT MM Genotype Normal levels of Inhibits neutrophil (normal liver and lung) M-AAT secreted elastase in the lung Z-AAT* ZZ Genotype Reduced levels of Minimal inhibition (fibrotic liver and decreased lung function) Z-A
Slide 19: Focused on Increasing AAT Levels in ZZ Patients to Between MM and MZ Levels
Focused on Increasing AAT levels in ZZ Patients to Between MM and MZ Levels Serum AAT levels (μM) = Median AAT for genotype 50 40 100% editing 30 Korro's goal for median editing has potential to reduce lung and liver risk 50% editing 20 Linear relationship with 10 total AAT and genotype 0 1 Odds Rat
Slide 20: KRRO-110 Designed to Correct Z-AAT Protein to M-AAT Protein
KRRO-110 Designed to Correct the Pathogenic Z-AAT Protein to M-AAT Protein in Preclinical Models Endogenous ADAR CHORD SERPINA1 mRNA Human KRRO-110 Liver Editing I A IV DELIVERY Edited SERPINA1 Remaining mutant SERPINA1 CHORD encapsulated in an LNP M-AAT Secreted Z-AAT Secreted Note: Editing is a fu
Slide 21: KRRO-110 Demonstrated >50% Editing in In Vitro Systems
KRRO-110 Demonstrated >50% Editing in In Vitro Systems with the Z Genotype 1 2 Editing in hepatocyte like cells (HLCs) Editing in human MZ hepatocytes KRRO-110 Transfection +IFN KRRO-110 uptake 100 100 80 80 60 40 60 20 40 0 1 10 100 10 100 1000 10000 Concentration (nM) Concentration (nM) Note: Data
Slide 22: Negligible In Vitro Cis Off-Target Editing for KRRO-110
Negligible In Vitro Cis Off-Target Editing Observed for KRRO-110 in MZ Hepatocytes MZ Primary Human Hepatocytes* KRRO-110 uptake 100 0 nM Editing at E342K site 25 nM 250 nM 2000 nM 80 60 Baseline E342K Allele 40 20 0 ACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGA
Slide 23: Achieved >50% Editing in Human Transgenic Mouse Model with a Single Dose
Achieved >50% Editing in Human Transgenic Mouse Model of Z Genotype with a Single Dose Study design Editing in NSG-PiZ mouse KRRO-110; 2mg/kg (single dose) 100 0 1 2 3 4 5 6 7 8 9 Week 80 NSG-PiZ Week 1 Week 9 mouse Results Results 60 I.V. 40 20 0 Control Week 1 Week 9 Well-tolerated in mice toxicit
Slide 24: Secretion of Functional AAT as Early as 7 Days Post-Single Dose
AAT concentration (μg/mL) Secretion of Functional AAT (~50uM) as Early as 7 Days Post-Single Dose NSG-PiZ mice elastase inhibition Serum human-AAT concentration KRRO-110; 2mg/kg (single dose) KRRO-110; 2mg/kg (single dose) 60 3240 Total AAT protein 3000 M-AAT 50 2500 40 25 2000 1500 0 20 1000 500 -2
Slide 25: Editing De Novo Adenosine on Cyno SERPINA1 in Higher Species
Editing De Novo Adenosine on Cyno SERPINA1 to Elucidate Editing in Higher Species Utility in PiZ mouse E342K target site for KRRO-110 Edited (M-AAT) protein detected A >98% homology SERPINA1 transcript of human ADAR A and cyno ADAR Surrogate target site to induce Utility in PiZ mouse and in NHPs ami
Slide 26: Editing at Surrogate Target Site Translated to Higher Species
Editing at Surrogate Target Site in AATD Mouse Model Translated to Higher Species Editing in C57BL/6-PiZ mice (%) Editing in NHPs (%) 2mg/kg (single dose) 2mg/kg (single dose) 2mg/kg (single dose) 100 100 KB-1494-GVT1 KB-1494-GVT1 80 80 60 60 40 40 20 20 0 0 Day 4 Day 14 Day 5 Day 15 Surrogate Targe
Slide 27: KRRO-110 Has Potential for Best-in-Class Profile for AATD Patients
KRRO-110 Has Potential for Best-in-Class Profile for AATD Patients Efficacy Safety Translation to higher species ✓ Achieved AAT levels ✓ No off-target effect ✓ Ability to edit in human cells between MM and MZ in observed to date ✓ Translation to NHP with rodents as early as ✓ No effect on endogenous
Slide 28: Creating De Novo Proteins
Creating De Novo Proteins Going Beyond “Repairing a Single Pathogenic Point Mutation 28
Slide 29: Creating De Novo Protein Variants to Modulate Protein Function
Creating De Novo Protein Variants to Modulate Protein Function Disrupting protein-to- Increasing protein expression / half-life protein interactions Single amino acid changes can have Preventing Disrupting aggregation of pathogenic protein a dramatic effect yet maintaining downstream function protei
Slide 30: Activation of Transcription Factor (TFX) by Creation of De Novo Protein
Activation of Transcription Factor (TFX) by Creation of De Novo Protein… In vitro editing of normal Downstream target gene TFX variant rescues Hep3B-CYP2E1 1 2 3 TFX in Hep3B cells expression in vivo in mouse liver cells from cytotoxicity 60 15 100 KB-3066 KB-1572 80 40 10 60 40 20 5 20 0 0 0 Cells
Slide 31: Sustained Downstream Activity in NHPs Lasting Longer than 21 Days
…and Sustained Downstream Activity in NHPs Lasting Longer than 21 Days Editing in liver cores (Day 3) Presence of TFX variant (Day 3) Durable presence of TFX variant (Day 21) 2mg/kg; QWx3 2mg/kg; QWx3 2mg/kg; QWx3 30 30 30 20 20 20 10 10 10 0 0 0 Control KB-1572 KB-1594 Control KB-1572 KB-1594 Contr
Slide 32: The Team
The Team KORRO3?
Slide 33: Experienced Management Team with Proven Track Record
Experienced Management Team with Proven Track Record Ram Aiyar, PhD Steve Colletti, PhD Vineet Agarwal Todd Chappell Shelby Walker Stephanie Engels Venkat Krishnamurthy, PhD Chief Executive Officer Chief Scientific Officer Chief Financial Officer Chief Operating Officer SVP, General Counsel SVP, HR
Slide 34: Board of Directors with Strong Development and Management Expertise
Board of Directors with Strong Development and Management Expertise Nessan Rachel Meyers, Ph.D. Timothy Pearson Jean-Francois Ali Behbahani, M.D. David Lucchino Ram Aiyar, Ph.D. Bermingham, Ph.D. Experienced operator in CEO, Carrick Formela, M.D. General Partner, NEA Co-founder, and President and CE
Slide 35: Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing
Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing Built an experienced team with a proven track record in genetic medicines TM Built an oligonucleotide-based approach (OPERA ) to affect a single base edit on RNA (efficient, specific and transient) Nominated a candi
Slide 36: Create transformative genetic medicines for diseases with high prevalence
Create transformative genetic medicines for diseases with high prevalence 36