Slide 1: Investor presentation Q2 2016
Investor presentation Q2 2016 Sample to Insight
Slide 2: Forward looking and intended use statements
Forward looking and intended use statements Safe Harbor Statement: Certain statements contained in this presentation may be considered forward-looking statements within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, and Section 21E of the U.S. Securities Exchange Act of 1
Slide 3: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q1 2016 results Appendix Sample to Insight Investor presentation Q2 2016 3
Slide 4: Building blocks of life: DNA and RNA
GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG AACAAGTTAATAAACTAAAT GGTTCTGGCATCGATGAAG AACAAGTTAATAAACTAAAT GGACCATAAAACTCCAGTG BUILDING BLOCKS OF LIFE AACAAGTTAA
Slide 5: Customers want molecular insights
Customers want molecular insights Faster Better More efficiently i The opportunity: Address demands for differentiated molecular testing solutions Sample to Insight Investor presentation Q2 2016 5
Slide 6: QIAGEN at a glance
QIAGEN at a glance 2015 sales ~$1.3 billion Customers >500,000 Global reach >35 countries Employees ~4,500 Share listings NASDAQ / Frankfurt Headquarters Netherlands We help customers gain insights to improve healthcare and advance science Sample to Insight Investor presentation Q2 2016 6
Slide 7: World leader in molecular testing solutions
SAMPLE TO INSIGHT SOLUTIONS Sample Technologies Assay Technologies Bioinformatics Automation systems VALUABLE BIOLOGICAL MOLECULAR SAMPLE INSIGHTS World leader in molecular testing solutions that enable valuable insights Sample to Insight Investor presentation Q2 2016 7
Slide 8: Expanding worldwide sales in established and emerging markets
Targeting high-growth markets Diversified global presence QIAGEN net sales in top 7 emerging markets 2015 adjusted net sales: $1.3 billion (In % of total QIAGEN sales) (In % of total QIAGEN sales) ~15% Europe / ~14% Middle East / ~32% ~12% Africa ~9% ~47% Americas Asia-Pacific / Japan / ~21% Rest of
Slide 9: Addressing the needs of >500,000 customers worldwide
QIAGEN sales by product group (As % of 2015 net sales: $1.3 billion) Molecular Diagnostics Consumables ~50% of sales (incl. bioinformatics) ~87% Applied Testing Pharma Life Sciences ~50% of sales ~13% Academia Instruments and automation solutions Addressing the needs of >500,000 customers worldwide
Slide 10: Building leadership across Life Sciences and Molecular Diagnostics
QIAGEN sales by customer class (As % of annual net sales) $1.3 bn $1.3 bn $1.2 bn 23% 22% Academia $1.0 bn 26% Life Sciences 26% 19% 20% Pharma 20% 8% 9% Applied Testing 21% 7% 3% U.S. HPV 16% 6% 20% 22% Molecular 46% Rest of portfolio Diagnostics 34% 27% 25% 2009 2011 2013 2015 MDx portfolio Applie
Slide 11: One core focus: Sample to Insight in molecular testing solutions
Customers Molecular Diagnostics Life Sciences Examples: Clinical Healthcare Applied Testing Pharma Academia Blood Technologies Sample Liquid biopsy Tissue Automation Other PCR Technologies NGS Assay QuantiFERON Other Software and Biox biological content TB / Immune Infectious Human ID / Pharma Life
Slide 12: Following a clear strategic development plan
1984 – 2000 2000 – 2004 2004 – 2013 >2014 COMPONENTS AUTOMATION WORKFLOWS SAMPLE TO INSIGHT SOLUTIONS Offer individual Automate individual Develop integrated Create hyper-connected technologies workflow steps automated workflows and high-utility solutions with full test menu Following a clear strate
Slide 13: Transforming QIAGEN to leadership in Molecular Diagnostics and Life Sciences
Molecular Applied Adjusted net sales overview: 2011-2015 Diagnostics Testing Pharma Academia In $ billions, as percentage of sales QIAsymphony $1.3 bn $1.3 bn Personalized $1.2 bn Healthcare (PHC) ~25% ~33% ~18% QuantiFERON-TB Bioinformatics ~67% ~65% ~64% GeneReader NGS System QIAseq universal solu
Slide 14: Making a difference in the most attractive areas
Making a difference in the most attractive areas of molecular diagnostics and life sciences Pioneer in liquid biopsy sample technologies Sample to Insight Investor presentation Q2 2016 14
Slide 15: Targeting $1 billion TB testing opportunity
Targeting $1 billion TB testing opportunity Sample to Insight Investor presentation Q2 2016 15
Slide 16: Accelerating NGS adoption in clinical healthcare
Accelerating NGS adoption in clinical healthcare Sample to Insight Investor presentation Q2 2016 16
Slide 17: Leading partner to pharma for companion diagnostics
Leading partner to pharma for companion diagnostics that help guide treatment decisions Sample to Insight Investor presentation Q2 2016 17
Slide 18: Automation to drive molecular testing dissemination
Automation to drive molecular testing dissemination Sample to Insight Investor presentation Q2 2016 18
Slide 19: Breakthroughs giving access to the excitement of science
Breakthroughs giving access to the excitement of science Sample to Insight Investor presentation Q2 2016 19
Slide 20: Leveraging the potential of QIAGEN's Sample to Insight portfolio
Sample Technologies QuantiFERON-TB GeneReader NGS System QIAseq universal solutions Personalized Healthcare (PHC) QIAsymphony Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight Investor presentation Q2 2016 20
Slide 21: Sample Technologies: Most trusted brand
Sample Technologies: Most trusted brand QIAGEN: #1 in Sample Technologies Needs QIAGEN offering Dedicated solutions for Differentiated and automated challenging samples types Sample Technology portfolio Highest level of quality Industry leader for liquid to extract biological targets biopsy
Slide 22: QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis
QuantiFERON-TB Gold: Advancing the global fight against Tuberculosis Latent TB testing total addressable market: $1 bn Needs QIAGEN offering Tuberculosis (TB) still a More than 7 million tests major global health burden delivered in 2015 Addressing latent TB critical New gold standard, repla
Slide 23: NGS: Driving dissemination into routine clinical use
NGS: Driving dissemination into routine clinical use ~80% of all NGS runs conducted on samples processed with QIAGEN Needs QIAGEN offering NGS workflows still hampered GeneReader: by many bottlenecks First complete Sample to Insight NGS solution Systems tailored for the clinical community >8
Slide 24: Personalized Healthcare: Pioneer in companion diagnostics
Personalized Healthcare: Pioneer in companion diagnostics Record number of 15 master collaboration agreements Needs QIAGEN offering Avoid “trial-and-error” 4 FDA approved tests medicine First CE-IVD liquid biopsy Improve treatment CDx for Iressa in lung cancer outcomes for patients Broades
Slide 25: QIAsymphony: Driving molecular testing dissemination
QIAsymphony: Driving molecular testing dissemination 2016 target: >1,750 installed systems Needs QIAGEN offering Flexible sample processing Continuous loading for highest level of flexibility Standardized workflow to ensure quality and safety Efficient and reliable sample preparation Compr
Slide 26: Bioinformatics: Best in-class data analysis and interpretation
Bioinformatics: Best in-class data analysis and interpretation Expected output of NGS data in 2015: 1.5 billion DVDs Needs QIAGEN offering NGS drives sharp increase in Global market leader in output of raw biological data commercial bioinformatics Emerging clinical >420,000 samples analyzed
Slide 27: Disciplined capital allocation
DISCIPLINED CAPITAL ALLOCATION Reinvest for organic growth Increase returns Targeted M&A / licensing Strengthen our premium > $500 m returned to Continuing our strategy Sample to Insight portfolio shareholders (2013-2015) Novel technologies Repurchases of shares Molecular test content an
Slide 28: Summary
Summary Expanding leadership in Sample to Insight solutions Leading positions in the most exciting areas of molecular diagnostics and life sciences Delivering growth during transformation 2016: Setting QIAGEN on a course to accelerate growth and drive further innovation Sample to Insight Investor pr
Slide 29: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q1 2016 results Appendix Sample to Insight Investor presentation Q2 2016 29
Slide 30: Leveraging the potential of QIAGEN's Sample to Insight portfolio
Sample Technologies QuantiFERON-TB GeneReader NGS System QIAseq universal solutions Personalized Healthcare (PHC) QIAsymphony Bioinformatics Leveraging the potential of QIAGEN’s Sample to Insight portfolio Sample to Insight Investor presentation Q2 2016 30
Slide 31: Sample Technologies
Sample Technologies Free circulating nucleic acids RNA and DNA from dead cells shed into the bloodstream, can contain cancer- related mutations. Exosomes Tiny microvesicles found in body fluids that transport RNA between cells. Circulating tumor cells Tumor cells shed from a tumor into the bloodstre
Slide 32: Sample Technologies
Sample Technologies QIAamp QIAsymphony Free circulating nucleic acids exoRNAeasy Exosomes QIAcube REPLI-g and AdnaGen Circulating tumor cells (CTCs) Setting the standards for liquid biopsy sample technologies Sample to Insight Investor presentation Q2 2016 32
Slide 33: Sample Technologies
Sample Technologies Strengthening our differentiated Sample Technology portfolio MO BIO: late 2015 acquisition Microbiome: fast growing area in research and clinical Challenge: extremely complex samples (skin, feces, soil, waste water, etc.) Patented Inhibitor Removal Technology® Complemen
Slide 34: QuantiFERON-TB: latent TB target groups
QuantiFERON-TB Latent tuberculosis infection (LTBI) Latent tuberculosis test target groups Public health TB control 1 in 3 people Employment Medical staff worldwide… screening Fire and police exposed to TB Congregated Correctional sites will develop latent TB living Military Universities
Slide 35: QuantiFERON-TB
QuantiFERON-TB Tuberculin Skin Test (1890s) QuantiFERON-TB (2000s) 2-4 visits required Single visit, results in <24 hours Subjective, low specificity: 65.9% Objective, high specificity: 99.2% Not reliable for TB-vaccinated people Can rule out use of BCG vaccine Proven clinical and workfl
Slide 36: Next-generation sequencing
Next-generation sequencing Ease of use Reliable results Unique automation Data interpretation QIAcube® GeneRead QIAcube® GeneReaderTM Bioinformatics portfolio NGS SAMPLE PREPARATION ALIGNMENT / PRIMARY ANALYSIS / SAMPLE NGS RUN TARGET LIBRARY CLONAL INTERPRETATION / TECH ENRICHMENT PREP AMPLIFICATIO
Slide 37: Key benefits of GeneReader NGS System
Next-generation sequencing Key benefits of GeneReader NGS System 1. First complete NGS workflow 2. Actionable insights Seamless integration Reports linked to proven gene panel Single vendor for full solution Highest-quality bioinformatics platform 3. High flexibility 4. Guaranteed results 5.
Slide 38: NGS: GeneReader NGS System near-term roadmap
NGS: GeneReader NGS System near-term roadmap* Selected application and menu expansion QIAact Breast Panel (expanded) QIAact Lung Panel (CNV and Fusion) QIAact Breast Panel QIAact Lung Panel (CNV) System and workflow upgrades QCI enhancements Full workflow performance control Sample type
Slide 39: Personalized Healthcare
Personalized Healthcare Selected partners QIAGEN: CDx partner of choice No. 1 in PCR-based companion diagnostics FDA approvals: KRAS and EGFR Selected key success factors Broadest platform range (PCR / NGS / Modaplex) Linking content and interpretation Independence Regulatory and reimb
Slide 40: Personalized Healthcare: selected co-development projects
Personalized Healthcare Selected co-development projects Project Partner Indication Biomarkers Status Lung cancer glesatinib MET Master collaboration agreement (NSCLC) Iressa Lung cancer 2015: U.S. FDA approval EGFR (gefitinib) (NSCLC) 2014: First-ever liquid biopsy CE-IVD (galeterone) Prostate canc
Slide 41: QIAsymphony
QIAsymphony 2016 goal: Breaking through >1,750 installed systems Molecular Diagnostics Applied Testing Academia / Pharma Healthcare-acquired infections Forensics / Human ID Translational medicine Women’s health Veterinary medicine Gene panels / Food safety Biomarker testing Transplan
Slide 42: Bioinformatics
Bioinformatics 40 ~80% out of the 40 top Pharma companies rely on QIAGEN bioinformatics solutions of all NGS runs enabled by QIAGEN >30,000 ~250 publications referencing QIAGEN bioinformatics products for >14 sample preparation validated GeneRead V2.0 panels >420,000 sequenced samples uploaded into
Slide 43: Bioinformatics
Bioinformatics Preparation Sequencing Analysis Interpretation CLC Ingenuity Discovery RNA-Seq Genomic Pathway Workbench Analysis CLC Ingenuity Discovery DNA-Seq Genomic Variant Workbench Analysis Ingenuity BIOLOGICAL CLC Cancer VALUABLE Translational DNA-Seq Variant SAMPLE Workbench MOLECULAR Analys
Slide 44: Bioinformatics: QIAGEN Clinical Insight
Bioinformatics QIAGEN Clinical Insight Fully integrated, web-based workflow Allows scaling of NGS test service offerings Comprehensive and rapid annotation, classification and reporting of variants Somatic and hereditary cancer tests at start Built for full regulatory and data security nee
Slide 45: Bioinformatics
Bioinformatics Industry-leading RNA sequencing portfolio Technology boost for single-cell sequencing Launch of 170 new QIAseq Targeted Co-marketing and co-development collaboration RNA Panels in February with 10X Genomics since February Content expansion incorporates knowledge from Linked-Re
Slide 46: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q1 2016 results Appendix Sample to Insight Investor presentation Q2 2016 46
Slide 47: 2015: Quarterly and full-year results overview
2015: Quarterly and full-year results overview In $ millions Q1 2015 Q2 2015 Q3 2015 Q4 2015 Full-year (Except EPS) 2015 Adjusted net sales 298.7 319.5 314.6 348.5 1,281.2 Adjusted gross profit 218.1 225.7 222.3 246.0 912.0 Adjusted gross profit margin 73% 71% 71% 71% 71% Adjusted operating income 6
Slide 48: Full-year 2015: Adjusted net sales and EPS
Full-year 2015: Adjusted net sales and EPS 2015 adjusted net sales development 2015 adjusted diluted EPS development (In $ billions) (In $ per share) +$0.13 $1.13 CER CER -$0.08 +3% CER $1.05 $1.35 bn -5% $1.00 $1.28 bn -3 p.p. +6% CER -8% p.p. ~3% ~97% of sales of sales 2014 2015 2015 2015 FX 2015
Slide 49: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q1 2016 results Appendix Sample to Insight Investor presentation Q2 2016 49
Slide 50: Overview: Q1 2016
Overview: Q1 2016 1 Q1 2016 results Q1 adjusted net sales: $298 million +2% CER (0% actual); adjusted EPS: $0.19 CER ($0.19) Adjusted operating income margin (18% of sales) reflects planned growth investments Key investment areas: Commercial channels, new products and geographic expansion 2 Se
Slide 51: Q1 2016: Adjusted net sales by customer classes
Q1 2016: Adjusted net sales by customer classes Q1 2016 adjusted net sales: $298.4 million Consumables and related revenues +2% CER / ~88% of sales Instruments +6% CER / ~12% of sales MDx portfolio excl. U.S. HPV +6% CER +2% CER ~45% of sales Molecular Diagnostics ~48% of sales U.S. HPV -40% CER ~3%
Slide 52: Q1 2016: Achievements
Q1 2016: Achievements Sample Technologies QuantiFERON-TB Next-generation sequencing Addition of MO BIO a key driver Investments drive sales above Successful GeneReader NGS System for microbiome applications 25% CER growth rate launch, broad and fast uptake JAMA article: QIAGEN liquid biopsy
Slide 53: Q1 2016: Income statement summary
Q1 2016: Income statement summary In $ millions (Unless indicated) Q1 2016 Q1 2015 Change Net sales 298.4 298.4 0% Adjusted net sales 298.4 298.7 0% Adjusted net sales (CER) 305.6 298.7 2% Gross profit 184.7 197.9 -7% Adjusted gross profit 207.5 218.1 -5% Adjusted gross profit margin 70% 73% Operati
Slide 54: Q1 2016: Reconciliation adjusted results
Q1 2016: Reconciliation adjusted results In $ millions Net Gross Operating Pretax Income Tax Net Diluted (Except EPS) sales profit income income tax rate income EPS Reported results 298.4 184.7 15.4 8.9 5.9 NM 14.9 0.06 Adjustments Business integration 3.0 8.4 8.4 -2.8 5.6 0.03 and acquisition-relat
Slide 55: Q1 2016: Balance sheet and cash flow
Q1 2016: Balance sheet and cash flow As of March 31 2016 2015 Leverage ratio: Net debt / EBITDA1 Group liquidity (In $ millions) 447 392 3,5 3.3 Net debt (In $ millions) 616 661 3,0 Shareholder equity ratio 64% 59% 2,5 Net debt / adjusted EBITDA ratio(1) 1.5x 1.5x 2.2 2,0 1.6 1,5 1,5 1.3 1.1 0.9 0.9
Slide 56: Q1 2016: Reaffirming targets
Q1 2016: Reaffirming targets 2016 adjusted net sales outlook 2016 adjusted diluted EPS outlook (At constant exchange rates, and as percentage of sales) (In $ per share) ~+6% CER ~$1.10-1.11 CER(1) ~+6% CER(1) $1.05 MO BIO ~1 p.p. acquisition (late 2015) +3% CER Enzymatics ~5 p.p. acquisition Rest of
Slide 57: Q2 and full-year 2016: Outlook and assumptions
Q2 and full-year 2016: Outlook and assumptions Q2 2016 outlook Full-year 2016 outlook Adjusted net sales(1) ~+4% CER ~+6% CER ~$0.22 CER ~$1.10-1.11 CER Adjusted diluted EPS(2) (Prior year: $0.26) (Prior year: $1.05) Amortization of acquired intellectual property (In $ millions) ~30 ~120 Business in
Slide 58: Agenda
Agenda Introducing QIAGEN Portfolio review 2015 results Q1 2016 results Appendix Sample to Insight Investor presentation Q2 2016 58
Slide 59: Global reach into the most attractive geographic markets
Global reach into the most attractive geographic markets Aarhus Manchester Venlo Hilden Hombrechtikon Stockach Redwood Waltham Germantown City Shanghai Shenzhen Hilden, Germany Europe Germantown, Maryland Shanghai Americas Asia-Pacific Sample to Insight Investor presentation Q2 2016 59
Slide 60: Q1 2016: Employees as of March 31, 2016
Q1 2016: Employees as of March 31, 2016 Europe / Total Total Asia Pacific / Americas Middle East / Change Japan / ROW Q1 2016 Q1 2015 Africa Production 304 588 104 996 954 4% R&D 224 706 93 1,023 950 8% Sales 587 701 525 1,813 1,654 10% Marketing 80 162 80 322 306 5% Admin 96 303 66 465 433 7% Total
Slide 61: Your contacts
Your contacts John Gilardi Dr. Sarah Fakih Alexandra Koenig Vice President Associate Director Coordinator Corporate Communications and IR Investor Relations Investor Relations Phone: +49 2103 29 11711 Phone: +49 2103 29 11457 Phone: +49 2103 29 11709 or +1 240 686 2222 Mobile: +49 152 018 11457 Mobi