Softbank Group Corp. · TSE:9984
Softbank — Q3 FY2020 Earnings Presentation
144 slides from Softbank's earnings presentation, Feb 8, 2021
Slide 1: Earnings Results for the 9-month Period ended December 31, 2020
Earnings Results for the 9-month Period ended December 31, 2020 February 8, 2021
Slide 2: Disclaimers
Disclaimers This presentation provides relevant information about SoftBank Group Corp. (“SBG”) and its subsidiaries (together with SBG, the “Company”) and its affiliates (together with the Company, the “Group”) and does not constitute or form any solicitation of investment including any offer to buy
Slide 3: is om SoftBank >
is om SoftBank >
Slide 4: 3
3
Slide 5: Consolidated Results
Consolidated Results 4
Slide 6: Net Income
Net Income (USD 29.5bn) (JPY bn) 3,055.2 YoY 6.4x 476.6 FY19 Q1-Q3 FY20 Q1-Q3 USD 1 = JPY 103.50 (as of Dec. 30, 2020 TTM) Net income: net income attributable to owners of the parent 5
Slide 7: NAV (Net Asset Value)
NAV (Net Asset Value) (USD bn) 221 200 USD +21bn in 9 months Mar. 31, 2020 Dec. 31, 2020 Share price: closing price as of Dec. 30, 2020 (Japan), closing price as of Dec. 31, 2020 (U.S.) For details, see “Definition and Calculation Method of SBG’s Sum-of-the-parts Valuation (as of Dec. 31, 2020)” 6
Slide 8: LTV (Net Debt / Equity Value of Holdings)
LTV (Net Debt / Equity Value of Holdings) (USD bn) 260 15% Manage LTV below 25% in normal times 39 Equity value Net debt of holdings Share price: closing price as of Dec. 30, 2020 (Japan), closing price as of Dec. 31, 2020 (U.S.) For details, see “Definition and Calculation Method of SBG’s Sum-of-th
Slide 9: Arm - NVIDIA
Arm - NVIDIA 8
Slide 10: The SoftBank Group seeks to sell all the shares
The SoftBank Group seeks to sell all the shares (announced in Sep. 2020) *All shares of Arm Limited (“Arm”, a wholly owned subsidiary of the Company) held by SoftBank Group Capital Limited ("SBGC", a wholly owned subsidiary of the Company) and SVF1 Closing of the transaction is conditional upon cust
Slide 11: Combination of Ecosystems
Combination of Ecosystems CPU Open-licensing model (continue customer neutrality) Client Infrastructure AI/ML IoT and embedded Automotive Closing of the transaction is conditional upon customary and other conditions being satisfied, including regulatory approval in (among other jurisdictions) the US
Slide 12: Combination of Ecosystems
Combination of Ecosystems CPU GPU / DPU BOO ARM A ECO EM WITH NVIDIA ACCELERATED COMPUTING Open-licensing model Leading AI computing (continue customer neutrality) Arm CPU Ecosystem platform NVIDIA Accelerated Computing Platform Client Infrastructure AI/ML Client Infrastructure AI/ML + Gaming Pro Vi
Slide 13: Create the world's premier computing company for the age of AI
+ Vast ecosystem and A I computing capabilities unique business model (leading GPU / DPU technology) Drug discovery Self-driving car Cloud Robotics Climate change Aspires to Create the world’s premier computing company for the age of A I Closing of the transaction is conditional upon customary and o
Slide 14: is om SoftBank >
is om SoftBank >
Slide 15: Gop =6rsCOTNDANY
Gop =6rsCOTNDANY
Slide 16: SoftBank Producer
— SoftBank Producer —
Slide 17: a= OOftBank « Pretucer of ,
a= OOftBank « Pretucer of , Group
Slide 18: wa OOftBank
wa OOftBank Group nh
Slide 19: *1 Arm is the investment from both SBGC and SVF1. Closing of the transaction
*1 KK *1 Arm is the investment from both SBGC and SVF1. Closing of the transaction is conditional upon customary and other conditions being satisfied, including regulatory approval in (among other jurisdictions) the US, UK, EU and China. Closing of the Third-party logos included herein are provided
Slide 20: ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09
’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 (FY) 19
Slide 21: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 22: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 23: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 24: IPOs = A company that IPOed since the initial investment (whether or not the
*1 *1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not t
Slide 25: IPOs = A company that IPOed since the initial investment (whether or not the
*2 *1 *2 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or no
Slide 26: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Announced a divestment or divested with investment gain of 10bn yen or
Slide 27: IPOs = A company that IPOed since the initial investment (whether or not the
*1 *1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Announced a divestment or divested with investment gain of 10bn yen
Slide 28: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 29: IPOs = A company that IPOed since the initial investment (whether or not the
*1 *2 (UK , et c.) ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Announced a divestment or divested with investment gai
Slide 30: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 31: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 32: IPOs = A company that IPOed since the initial investment (whether or not the
*1 *1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not t
Slide 33: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 A company that IPOed since the initial investment (whether or not the
Slide 34: IPOs = A company that IPOed since the initial investment (whether or not the
*1 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Announced a divestment or divested with investment gain of 10bn yen or
Slide 35: SoftBank Vision Fund
SoftBank Vision Fund *1 *2 *2 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 ZhongAn is the investment from SVF1 (FY) *S
Slide 36: SoftBank Vision Fund
SoftBank Vision Fund *1 *3 *4 *1 *2 *4 *1 *2 *2 KK KK ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Flipkart, Ping An G
Slide 37: SoftBank Vision Fund
SoftBank Vision Fund *1 *2 *1 *2 *4 *1 *2 *4 *1 *2 *1 *2 *1 *3 *4 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not taken into *1 Uber, S
Slide 38: SoftBank Vision Fund
*3 *5 *6 *2*4 *2 *4 SoftBank *2 *4 Vision Fund *1 *4 *1 *4 *1 *4 *1 *4 *1 *5 *4 *5 ’96 ’97 ’98 ’99 ’00 ’01 ’02 ’03 ’04 ’05 ’06 ’07 ’08 ’09 ’10 ’11 ’12 ’13 ’14 ’15 ’16 ’17 ’18 ’19 ’20 IPOs = A company that IPOed since the initial investment (whether or not the investment cost was exceeded is not take
Slide 39: SoftBank Vision Fund: SVF1 and Other SBIA-Managed Funds Segment
SoftBank Vision Fund: SVF1 and Other SBIA-Managed Funds Segment 15 IPOs, etc.: total number of companies listed by using an IPO, a direct listing or merged with SPAC after initial investment from SVF1 or SVF2 (SVF1: 12 companies, SVF2: 3 companies), incl. fully exited investments, since May 20, 2017
Slide 40: SoftBank Vision Fund
SoftBank Vision Fund SoftBank Vision Fund: SVF1 and Other SBIA-Managed Funds Segment 39
Slide 41: SoftBank Vision Fund
SoftBank Vision Fund (131 companies) SoftBank Vision Fund 2 (39 companies: 26 portfolio companies + 2 portfolio companies SoftBank Vision Fund 1 (92 companies) invested in since Jan. 1, 2021 + 11 pipeline companies) (Beike) + JVs / affiliates etc. (14 companies) + Fully exited + Others (10 companies
Slide 42: Gain and Loss on Investments (Quarter)
Gain and Loss on Investments (Quarter) (SVF Segment on a SBG Consolidated Basis) (JPY bn) 1,355.7 1,115.0 248.4 320.0 519.8 392.0 414.4 Return to profit 106.9 87.5 77.8 296.6 71.0 -199.7 On Apr. 1, 2020, Sprint ceased to be a subsidiary of the Company following the completion of the merger between S
Slide 43: Gain and Loss on Investments (9-month Cumulative)
Gain and Loss on Investments (9-month Cumulative) (SVF Segment on a SBG Consolidated Basis) JPY 2,767.3bn Return to profit JPY 1,088.2bn On Apr. 1, 2020, Sprint ceased to be a subsidiary of the Company following the completion of the merger between JPY 265.4bn Sprint and T-Mobile US, Inc. Given that
Slide 44: SVF1 Listed Portfolio Companies (as of Dec. 31, 2020)
SVF1 Listed Portfolio Companies (as of Dec. 31, 2020) (USD m) (a) (b) (c) = (b) - (a) (d) = (b) / (a) Investment cost Gross return *3 Gross gain/(loss) *4 Company Gross MOIC to SVF1 to SVF1 to SVF1 Doordash 680 8,989 +$8,309 13.2x Uber 7,666 11,334 +$3,668 1.5x Guardant Health 308 2,728 +$2,420 8.9x
Slide 45: SVF2 Listed Portfolio Companies (as of Dec. 31, 2020)
SVF2 Listed Portfolio Companies (as of Dec. 31, 2020) (USD m) (a) (b) (c) = (b) - (a) (d) = (b) / (a) Investment cost Gross return *2 Gross gain/(loss) *3 Company Gross MOIC to SVF2 to SVF2 to SVF2 Beike 1,350 6,433 +$5,083 4.8x Seer 55 163 +$108 3.0x (A) Listed company total (Gross)*1 $1,405 $6,596
Slide 46: Investment Results for Doordash
SVF1 Investment Investments Results for Doordash (as of Dec. 31, 2020) IPO on Dec. 9, 2020 USD 8,989m US’s No.1 Online food delivery 13.2x *US’s No.1 Online food delivery in terms of online market share of transactions across food delivery vendors, between October 1, 2020 and October 13, 2020: (Sour
Slide 47: Investment Results for Uber
SVF1 Investment Investments Results for Uber (as of Dec. 31, 2020) IPO on May 10, 2019 USD 11,334m The global leader in mobility and delivery services USD 7,666m 1.5x *Global: ex-China Past performance is not necessarily indicative of future results. Select investment presented herein is solely for
Slide 48: Investment Results for Guardant Health
SVF1 Investment Investments Results for Guardant Health (as of Dec. 31, 2020) IPO on Oct. 4, 2018 USD 2,728m Comprehensive liquid biopsy utilizing A I 8.9x USD 308m Past performance is not necessarily indicative of future results. Select investment presented herein is solely for illustrative purpose
Slide 49: Investment Results for Opendoor
SVF1 Investment Listed on Dec. 21, 2020 Investments Results for Opendoor (as of Dec. 31, 2020) (merged with SPAC*) USD 1,673m Online real estate transaction platform 3.7x USD 450m *Opendoor merged with Social Capital Hedosophia Holdings Corp. II on Dec. 18, 2020, and the trading was begun on the Nas
Slide 50: Investment Results for Relay Therapeutics
SVF1 Investment Investments Results for Relay Therapeutics (as of Dec. 31, 2020) IPO on Jul. 16, 2020 USD 1,160m Transform the drug discovery process through protein motion and AI 3.9x USD 300m Past performance is not necessarily indicative of future results. Select investment presented herein is so
Slide 51: Investment Results for Slack
SVF1 Investment Listed on Jun. 20, 2019 Investments Results for Slack (as of Dec. 31, 2020) (Direct listing) Fully Exited USD 1,007m Provides the software platform to communicate and collaborate 3.0x USD 334m Since the investment was fully exited by Dec. 31, 2020, Gross Return to SVF1 as of Dec. 31,
Slide 52: Investment Results for Ping An Good Doctor
SVF1 Investment Investments Results for Ping An Good Doctor (as of Dec. 31, 2020) IPO on May 4, 2018 Fully Exited One of the leading one-stop USD 828m online healthcare platforms in China 2.1x USD 400m Since the investment was fully exited by Dec. 31, 2020, Gross Return to SVF1 as of Dec. 31, 2020 i
Slide 53: Investment Results for Vir Biotechnology
SVF1 Investment Investments Results for Vir Biotechnology (as of Dec. 31, 2020) IPO on Oct. 11, 2019 USD 606m Develop therapies & vaccines utilizing AI 3.0x USD 199m Past performance is not necessarily indicative of future results. Select investment presented herein is solely for illustrative purpos
Slide 54: Investment Results for 10x Genomics
SVF1 Investment Investments Results for 10x Genomics (as of Dec. 31, 2020) IPO on Sep. 12, 2019 Fully Exited USD 338m Accelerating biology with single-cell genomics 10.9x Since the investment was fully exited by Dec. 31, 2020, Gross Return to SVF1 as of Dec. 31, 2020 is the same as the USD 31m total
Slide 55: Investment Results for OneConnect
SVF1 Investment Investments Results for OneConnect (as of Dec. 31, 2020) IPO on Dec. 13, 2019 USD 100m Leading technology-as-a-service platform USD 88m for financial institutions in China 0.9x Past performance is not necessarily indicative of future results. Select investment presented herein is sol
Slide 56: Investment Results for ZhongAn
SVF1 Investment Investments Results for ZhongAn (as of Dec. 31, 2020) IPO on Sep. 28, 2017 USD 550m First online-only insurance company in China USD 394m 0.7x Past performance is not necessarily indicative of future results. Select investment presented herein is solely for illustrative purposes, has
Slide 57: Investment Results for Beike
SVF2 Investment Investments Results for Beike (as of Dec. 31, 2020) IPO on Aug. 13, 2020 USD 6,433m China’s No.1 platform for housing transactions and services* 4.8x USD 1,350m *China’s No.1 platform for housing transactions and services in terms of Gross Transaction Value, 2019: (Source) China Insi
Slide 58: Investment Results for Seer
SVF2 Investment Investments Results for Seer (as of Dec. 31, 2020) IPO on Dec. 4, 2020 USD 163m Innovate proteomic analysis (aggregate of proteins) 3.0x USD 55m Past performance is not necessarily indicative of future results. Select investment presented herein is solely for illustrative purposes, h
Slide 59: Investment Results for Auto1
SVF1 Investment Investments Results for Auto1 (as of Feb. 5, 2021) IPO on Feb. 4, 2021 USD 2,502m Europe’s leading platform for buying and selling used cars online 3.4x USD 742m Since Auto1 was a private company as of Dec. 31, 2020, the investment result is showing the latest performance at the SBG
Slide 60: Investment Results for Qualtrics
SVF2 Investment Investments Results for Qualtrics (as of Feb. 5, 2021) IPO on Jan. 28, 2021 USD 44m Leading software platform for managing customer and employee experiences 1.8x USD 24m Since SVF2 invested in Qualtrics after Dec. 31, 2020, the investment result is showing the latest performance at t
Slide 61: SVF1 Listed Portfolio Companies (1/2)
SVF1 Listed Portfolio Companies (1/2) 120 (USD bn) $75.7bn SVF1 private companies, etc. (from SVF1 inception through Dec. 31, 2020) $73.5bn $29.1bn SVF1 listed companies (from SVF1 inception through Dec. 31, 2020) 0 $11.0bn Investment Cost Gross Return to SVF1 to SVF1 SVF1 listed companies: companie
Slide 62: SVF1 and SVF2 Listed Portfolio Companies (1/2)
SVF1 Listed Portfolio Companies (1/2) SVF2 Listed Portfolio Companies (1/2) 120 (USD bn) 15 (USD bn) $75.7bn SVF1 private companies, etc. (from SVF1 inception through Dec. 31, 2020) $2.7bn SVF2 private companies (from SVF2 inception through Dec. 31, 2020) $73.5bn $2.9bn $6.6bn SVF2 listed companies
Slide 63: SVF1 Listed Portfolio Companies (2/2)
SVF1 Listed Portfolio Companies (2/2) 32 (USD bn) SVF1 listed companies $29.1bn (from SVF1 inception through Dec. 31, 2020) $0.4bn ZhongAn $0.1bn OneConnect $0.3bn 10x Genomics $0.6bn Vir Biotechnology $0.8bn Ping An Good Doctor $1.0bn Slack $1.2bn Relay Therapeutics $1.7bn Opendoor $2.7bn Guardant
Slide 64: SVF1 and SVF2 Listed Portfolio Companies (2/2)
SVF1 Listed Portfolio Companies (2/2) SVF2 Listed Portfolio Companies (2/2) 32 (USD bn) SVF1 listed companies 10 (USD bn) $29.1bn (from SVF1 inception through Dec. 31, 2020) $0.4bn ZhongAn $0.1bn OneConnect $0.3bn 10x Genomics $0.6bn Vir Biotechnology $0.8bn Ping An Good Doctor $1.0bn Slack $1.2bn R
Slide 65: SoftBank Vision Fund 2
SoftBank Vision Fund 2 64
Slide 66: SVF2 Portfolio Companies (as of Feb. 5, 2021)
SVF2 Portfolio Companies (as of Feb. 5, 2021) Company Initial investment date Company Initial investment date 1 Beike Nov. 2019 21 XAG Dec. 2020 2 Alto Pharmacy Dec. 2019 22 Seer Dec. 2020 3 Lenskart Dec. 2019 23 Tessera Therapeutics Dec. 2020 4 Karius Feb. 2020 24 Flock Freight Dec. 2020 5 Behavox
Slide 67: SVF2 Portfolio Companies (as of Feb. 5, 2021)
SVF2 Portfolio Companies (as of Feb. 5, 2021) Company Initial investment date Company Initial investment date 1 Beike Nov. 2019 21 XAG Dec. 2020 2 Alto Pharmacy Dec. 2019 22 Seer Dec. 2020 3 Lenskart Dec. 2019 23 Tessera Therapeutics Dec. 2020 4 Karius Feb. 2020 24 Flock Freight Dec. 2020 5 Behavox
Slide 68: AI × Early Education
SVF2 Investment A I × Early Education 67
Slide 69: Online early childhood education platform
SVF2 Investment 3 to 9 year-olds (intelligence development period) 4~6 children per class (small class) Math and logic training Online early childhood education platform The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of inves
Slide 70: The information contained herein is provided for illustrative purposes only. The information herein was
The information contained herein is provided for illustrative purposes only. The information herein was prepared by VIPThink. None of SBG, SVF2, the general partner of SVF2 or SBIA make any representation regarding the accuracy of the information and are under no obligation to update the information
Slide 71: Covering the Full Learning Cycle
SVF2 Investment Covering the Full Learning Cycle Preview Session Monitoring Exercise from parents Service renewal rate 85% (Source) VIPThink The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investments made by SBIA. Referenc
Slide 72: AI-powered learning service
SVF2 Investment Use of AI Analysis via camera Level test during class before / after class Facial Sitting Answer expres- Voices position speed sions Provide high- Personalized quality classes learning plan AI-powered learning service The investment herein is presented solely for illustrative purpose
Slide 73: AI × Higher Education
SVF2 Investment A I × Higher Education 72
Slide 74: India's online education platform
SVF2 Investment University entrance exam Civil service and government exam K-12 English learning Programming India’s online education platform The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investments made by SBIA. Refere
Slide 75: Unacademy users and live classes
SVF2 Investment Users Daily live classes Educators Total minutes watched 46m 4,500 50k 28.4bn Rich online contents (Source) Unacademy Users: cumulative number of registered students as of Dec. 2020 Daily live classes: as of Dec. 2020 Educators: cumulative number of educators onboarded as of Dec. 202
Slide 76: Mass distribution of high quality classes
SVF2 Investment Use of AI A I monitoring Simultaneous monitoring capability (No. of classes) 300 50x 6 Educator behavior Traditional AI monitoring Mass distribution of high quality classes (Source) Unacademy Traditional: Unacademy’s simultaneous monitoring capability as of Mar. 2019 The investment h
Slide 77: Rapid growth
SVF2 Investment Active Subscription 350 (Users k) 340k India started lock down (Mar. 25, 2020) Rapid growth 0 Jan. Feb. Mar. Apr. May.Jun. Jul. Aug.Sep. Oct. Nov.Dec. Jan. Feb. Mar. Apr. May.Jun. Jul. Aug.Sep. Oct. Nov.Dec. (End of each month) 2019 2020 The investment herein is presented solely for
Slide 78: AI × Fitness
SVF2 Investment A I × Fitness 77
Slide 79: China's leading online fitness platform
SVF2 Investment Sports contents Own products Workout Hardware Live class Electronics Food & Dietary advice beverages 210m users *1 China’s leading online fitness platform (Source) Keep *1 Registered users as of Dec. 2020 78 The investment herein is presented solely for illustrative purposes, has bee
Slide 80: The information contained herein is provided for illustrative purposes only. The information herein was
The information contained herein is provided for illustrative purposes only. The information herein was prepared by Keep. None of SBG, SVF2, the general partner of SVF2 or SBIA make any representation regarding the accuracy of the information and are under no obligation to update the information. Th
Slide 81: Provide one-stop fitness service
SVF2 Investment Ecosystem Purchase Exercise Linked data Community items Sports Mach Foods Keep Ana Solu -wear -ine count -lysis -tion Provide one-stop fitness service The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investme
Slide 82: Proposing customized solution
SVF2 Investment Use of AI Exercise data Personalized training solution 1+bn km Running and hiking tracked 1+bn Searches in app 100+bn Calories burned Entry level Advanced level Proposing customized solution (Source) Keep Exercise data: completed from Jan. - Aug. 2020 81 The investment herein is pres
Slide 83: AI × Proteomics
SVF2 Investment A I × Proteomics 82
Slide 84: Seer Nanoparticles Innovate Proteomics
SVF2 Investment Seer Nanoparticles Innovate Proteomics Biofluid Proteins Seer Nanoparticle Protein Corona (Proteome) The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investments made by SBIA. References to it should not be c
Slide 85: Utilization in early disease detection & therapy
SVF2 Investment Proteomics Genomics Proteomics Types & amounts Genetic information of proteins Future risk Current status Utilization in early disease detection & therapy The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of inve
Slide 86: Detection of Proteins
SVF2 Investment Detection of Proteins Traditional Screening C A A C A A A B A A A A C C B Throughput low The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investments made by SBIA. References to it should not be construed as
Slide 87: Detection of Proteins
SVF2 Investment Detection of Proteins Traditional Seer Binding proteins Screening with particular properties C A A C A C A A C A A A A A B B A A A A A A A A C A B C A A C A A B C A A A A Throughput low Throughput high The investment herein is presented solely for illustrative purposes, has been sele
Slide 88: Simplifies the preparation process significantly
SVF2 Investment Process of Proteome Analysis Traditional Seer Depletion Binding Concentration Nanoparticles Digestion / desalting Sample with Drying automation instrument Fractionation / concatenation Analysis Simplifies the preparation process significantly The investment herein is presented solely
Slide 89: Analyze proteins rapidly and at large-scale
SVF2 Investment Proteomics Throughput Processing time (Proteins per minute) 14.2 Few days~weeks * 1/17 9x 1.5 7hours Traditional Seer Traditional Seer Analyze proteins rapidly and at large-scale *Assumed as five days for the traditional method to process a protein The investment herein is presented
Slide 90: Use of AI
SVF2 Investment Use of AI Selection of Protein Nanoparticle (more than 1 million varieties) Nanoparticle AI (more than 275 nanoparticles) Maximization of types detected *Nanoparticle (more than 275 nanoparticles) : as of Jan. 2021 (Source) Seer 89 The investment herein is presented solely for illust
Slide 91: AI × Genome Editing
SVF2 Investment A I × Genome Editing 90
Slide 92: Diseases caused by genetic abnormalities
Diseases caused by genetic abnormalities Conventional Diabetes Hemophilia Alzheimer's *1 Cancer disease Color-blindness Parkinson's disease Cystic fibrosis Cataracts *2 Treating symptoms with medication and surgery *1 Hereditary predisposition for Alzheimer’s, *2 Refers to congenital diseases The in
Slide 93: Diseases caused by genetic abnormalities
Diseases caused by genetic abnormalities Conventional Diabetes Hemophilia Alzheimer's *1 Cancer disease Color-blindness Parkinson's disease Cystic fibrosis Cataracts *2 Genetic defects / errors Treating symptoms Curing disease with medication and surgery by correcting root cause *1 Hereditary predis
Slide 94: Insertion and editing of genetic information
SVF2 Investment Genetic defects / errors Mobile genetic elements Normal gene Insertion and editing of genetic information The investment herein is presented solely for illustrative purposes, has been selected to provide an example of the types of investments made by SBIA. References to it should not
Slide 95: Editing genetic information
SVF2 Investment Editing genetic information Writing Rewriting atgctagctacgagctatgctagctacgagctatg atgctagctacgagctatgctagctacgagctatg ctagctacgagctatgctagctacgagctatgcta ctagctacgagctatgctagctacgagctatgcta atgctagctacgagctatgctagctacgagctatg atgctagctacgagctatgctagctacgagctatg ctagctacgagctatgc▶︎agc
Slide 96: Writing
Writing Insertion of genetic information into missing parts The information contained herein is provided for illustrative purposes only. The information herein was prepared by Tessera Therapeutics. None of SBG, SVF2, the general partner of SVF2 or SBIA make any representation regarding the accuracy
Slide 97: Rewriting
Rewriting Correctly rewrite erroneous genetic information The information contained herein is provided for illustrative purposes only. The information herein was prepared by Tessera Therapeutics. None of SBG, SVF2, the general partner of SVF2 or SBIA make any representation regarding the accuracy of
Slide 98: Use of AI
SVF2 Investment Use of AI Mobile genetic elements Analysis and evaluation (identified thousands of candidates*) AI Developing effective gene therapy *Candidate mobile genetic factors that may be useful for gene therapy The investment herein is presented solely for illustrative purposes, has been sel
Slide 99: SoftBank Latin America Fund (33 investments)
SoftBank Latin America Fund (33 investments) 10 other portfolio companies and (FKA as Acesso Digital) LP interests As of Dec. 31, 2020 The information included herein is provided for illustrative purposes only and reflects investments made by SoftBank Latin American Fund L.P. (“SoftBank Latin Americ
Slide 100: SoftBank Latin America Fund Investment Highlights
SoftBank Latin America Fund Investment Highlights (as of Dec. 31, 2020) USD 3.0bn USD 2.3bn USD +0.7bn (from LatAm Fund inception in Oct. 2019 through Dec. 2020) Investment Cost Fair value The inception date of LatAm fund (Oct. 2019) is based on the date of Limited Partnership Agreement (LPA) and In
Slide 101: Fintech Case Study: Banco Inter
SoftBank Latin America Fintech Case Study: Banco Inter Fund Investment A rapidly growing USD 690m Brazilian financial platform 1.9x in USD digital accounts holders 8.5m USD 373m *1 Investment Cost means the aggregate capital invested on Nov. 26, 2019, Dec. 30, 2019, Aug. 20, 2020, Aug. 31, 2020 and
Slide 102: SoftBank Vision Fund1 (92 companies)
SoftBank Vision Fund1 (92 companies) SoftBank Vision Fund 1 (92 companies) + JVs / affiliates etc. (14 companies) + Fully exited (10 companies) The investments presented herein are solely for illustrative purposes, have been selected in order to demonstrate examples of SVF1 investments, and do not p
Slide 103: SoftBank Vision Fund1, 2 (131 companies)
SoftBank Vision Fund1, 2 (131 companies) SoftBank Vision Fund 2 SoftBank Vision Fund 1 (92 companies) (39 companies: 26 portfolio companies + 2 portfolio companies invested in since Jan. 1, 2021 + 11 pipeline companies) (Beike) + Others (2 companies) + 2 portfolio companies invested in since Jan.1,
Slide 104: SoftBank Vision Fund1, 2 + LatAm Fund (164 companies)
SoftBank Vision Fund1, 2 + LatAm Fund (164 companies) SoftBank Vision Fund 2 advised by SBIA SoftBank Vision Fund 1 (92 companies) (39 companies: 26 portfolio companies + 2 portfolio companies SoftBank Latin America Fund (33 companies) advised by SBIA invested in since Jan. 1, 2021 + 11 pipeline com
Slide 105: Incubation platform in Japan
Incubation platform in Japan + SBG / SVF portfolio companies with cutting-edge business models (Note) The business integration of Z Holdings and LINE Corporation is expected to be completed in Mar. 2021 Certain joint ventures and collaborations of SoftBank Corp., SVF1, SVF2 and SoftBank Group Corp.
Slide 106: Produce new unicorns in Japan
New Business Fields: SBKK’s “Beyond Carrier” Strategy For DiDi logo: DiDi Mobility Japan Corp. For WeWork logo: WeWork Japan GK For OYO logo: OYO Japan For Mapbox logo: Mapbox Japan Produce new unicorns in Japan FinTech Security Mobility Endpoint security MaaS Mobile payment Device security Self-dri
Slide 107: 106
106
Slide 108: wa OOftBank
wa OOftBank Group
Slide 109: Turbocharger strategy
— SoftBank Turbocharger strategy 108
Slide 110: Turbocharger strategy
ea OOftBank Group Turbocharger strategy — 109
Slide 111: Turbocharger strategy
— SoftBank ~ Preface of godden exgen
Slide 112: Turbocharger strategy
Turbocharger strategy Bigger vision More capital Group synergies 111
Slide 113: SoftBank Vision Fund1, 2 + LatAm Fund (164 companies)
SoftBank Vision Fund1, 2 + LatAm Fund (164 companies) SoftBank Vision Fund 2 advised by SBIA SoftBank Vision Fund 1 (92 companies) (39 companies: 26 portfolio companies + 2 portfolio companies SoftBank Latin America Fund (33 companies) advised by SBIA invested in since Jan. 1, 2021 + 11 pipeline com
Slide 114: Image included herein are provided for illustrative purposes only. It does not imply current
Image included herein are provided for illustrative purposes only. It does not imply current or future specific fund investments or its performance. 113
Slide 115: Nothing contained herein should be relied upon as a promise or representation as to
Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 114
Slide 116: Nothing contained herein should be relied upon as a promise or representation as to
Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 115
Slide 117: Nothing contained herein should be relied upon as a promise or representation as to
Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 116
Slide 118: Nothing contained herein should be relied upon as a promise or representation as to
Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 117
Slide 119: The slides presented herein are solely for illustrative purposes to provide an example of
The slides presented herein are solely for illustrative purposes to provide an example of SBG's overall strategy for the future. Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 118
Slide 120: The slides presented herein are solely for illustrative purposes to provide an example of
The slides presented herein are solely for illustrative purposes to provide an example of SBG's overall strategy for the future. Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 119
Slide 121: The slides presented herein are solely for illustrative purposes to provide an example of
The slides presented herein are solely for illustrative purposes to provide an example of SBG's overall strategy for the future. Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 120
Slide 122: Music source: PIXTA Nothing contained herein should be relied upon as a promise or
Music source: PIXTA Nothing contained herein should be relied upon as a promise or representation as to future performance of the SBG. 121
Slide 123: (Time) 122
(Time) 122
Slide 124: (Time) 123
Mwy (Time) 123
Slide 125: (Time) 124
(Time) 124
Slide 126: (Time) 125
(Time) 125
Slide 127: (Time) 126
Pvesbotien of Tew feemebeggy i aru) “126-
Slide 128: SKIES
VA SKIES kind eae aes i reatet by Huma
Slide 129: Nee)
Nee) ZNZ\
Slide 130: SoftBank
SoftBank
Slide 131: Appendix
Appendix
Slide 132: Definition and Calculation Method of SBG's Sum-of-the-Parts Valuation
Definition and Calculation Method of SBG’s Sum-of-the-Parts Valuation (as of December 31, 2020) 1. NAV Net Asset Value ◦ NAV = Equity value of holdings - Net debt 2. Equity value of holdings (after deducting asset-backed financing) ◦ SBKK: calculated by multiplying the number of SBKK shares held by
Slide 133: Definition and Calculation Method of SBG's Sum-of-the-Parts Valuation
Definition and Calculation Method of SBG’s Sum-of-the-Parts Valuation (as of March 31, 2020) 1. NAV Net Asset Value ◦ NAV = Equity value of holdings - Net debt 2. Equity value of holdings (after deducting asset-backed financing) ◦ SBKK: calculated by multiplying the number of SBKK shares held by SBG
Slide 134: Gain and Loss on Investments (Cumulative)
Gain and Loss on Investments (Cumulative) (SVF Segment on a SBG Consolidated Basis) (JPY bn) 2,745.8 2,237.8 1,823.4 1,431.4 1,294.1 1,390.1 On Apr. 1, 2020, Sprint ceased to be a subsidiary of the Company following the completion of the merger between Sprint and T-Mobile US, Inc. Given that investm
Slide 135: SVF1 Investment Highlights (SBG Consolidated basis)
SVF1 Investment Highlights (SBG Consolidated basis) * (From SVF1 inception through Dec. 31, 2020) USD 34.5bn USD 20.4bn Realized gain USD 7.4bn Investment market uplift + realized gains Valuation gain USD -14.1bn Realized loss USD 27.1bn Valuation loss USD -0.7bn USD -13.4bn Mark up Mark down (40 in
Slide 136: SVF1 Listed Portfolio Companies (as of Feb. 5, 2021)
SVF1 Listed Portfolio Companies (as of Feb. 5, 2021) (USD m) (a) (b) (c) = (b) - (a) (d) = (b) / (a) Investment cost Gross return*2 Gross gain/(loss) *3 Company Gross MOIC to SVF1 to SVF1 to SVF1 Doordash 680 11,413 +$10,733 16.8x Uber 7,666 12,824 +$5,158 1.7x Guardant Health 308 2,942 +$2,634 9.6x
Slide 137: SVF1 Investment Highlights (1)
SVF1 Investment Highlights (1) (SBG Consolidated basis) * (From SVF1 inception through Dec. 31, 2020) Cumulative gross gain to SVF1 private companies USD 2.2bn Cumulative gross gain to SVF1 listed companies USD 18.1bn Cumulative investment cost to SVF1 listed companies USD 11.0bn Listed company tota
Slide 138: SVF1 Investment Highlights (2)
SVF1 Investment Highlights (2) (SBG Consolidated basis) * Cumulative gross gain to SVF1 private companies (From SVF1 inception through Dec. 31, 2020) USD 2.1bn Cumulative gross gain to SVF1 listed companies (From SVF1 inception through Feb. 5, 2021) USD 25.5bn Cumulative investment cost to SVF1 list
Slide 139: SVF1 Snapshot (as of Dec. 31, 2020)
SVF1 Snapshot (as of Dec. 31, 2020) (USD billion) (a) (b) (c) = (b) - (a) *2 *1 Investment cost Gross return Gross gain/(Loss) to SVF1 to SVF1 to SVF1 (A) Listed company total *3 $11.0 $29.1 +$18.1 (B) Private company, etc. total $73.5 $75.7 +$2.2 (C)=(A)+(B) SVF 1 total (SBG consolidated basis) *4
Slide 140: SVF2 Investment Highlights
SVF2 Investment Highlights (From SVF2 inception through Dec. 31, 2020) Realized gain USD 7.4bn USD 5.4bn USD 5.0bn Investment Valuation gain market uplift + USD 5.4bn USD -0.4bn Realized loss USD -0.04bn Valuation loss USD -0.4bn realized gains Mark up Mark down (5 investments) (4 investments) SVF2
Slide 141: SVF2 Listed Portfolio Companies (as of Feb. 5, 2021)
SVF2 Listed Portfolio Companies (as of Feb. 5, 2021) (USD m) (a) (b) (c) = (b) - (a) (d) = (b) / (a) *2 Investment cost Gross return Gross gain/(loss) *3 Company Gross MOIC to SVF2 to SVF2 to SVF2 Beike 1,350 6,546 +$5,196 4.8x Seer 205 338 +$133 1.7x Qualtrics 24 44 +$20 1.8x Listed company total (
Slide 142: SVF2 Investment Highlights (1)
SVF2 Investment Highlights (1) (From SVF2 inception through Dec. 31, 2020) Cumulative gross gain to SVF2 listed companies USD 5.2bn Listed company total only includes companies that have become publicly listed after SVF2 made Cumulative investment cost to its initial investment in the companies. USD
Slide 143: SVF2 Investment Highlights (2)
SVF2 Investment Highlights (2) Cumulative gross gain to SVF2 listed companies USD 5.3bn (From SVF2 inception through Feb. 5, 2021) Cumulative investment cost to Listed company total only includes companies that have become publicly listed after SVF2 made its initial investment in the companies. SVF2
Slide 144: SVF2 Snapshot (as of Dec. 31, 2020)
SVF2 Snapshot (as of Dec. 31, 2020) (USD billion) (a) (b) (c) = (b) - (a) *2 *1 Investment cost Gross return Gross gain/(Loss) to SVF2 to SVF2 to SVF2 SVF 2 total $4.3 $9.3 +$5.0 (d) (e) Paid-in capital Total value SBG total (Net) $4.4 $9.3 *3 (Breakdown) Net asset value $8.1 *4 Distributions - *5 P