Prime Medicine, Inc. · NASDAQ:PRME
Prime Medicine — Technical Presentation (October 2023)
17 slides from Prime Medicine's technical presentation, October 2023
Slide 1: Prime Editing in Hematopoietic Diseases and Beyond: Efficacy and Safety
Prime Editing in Hematopoietic Diseases and Beyond: Efficacy and Safety Jacob Stewart-Ornstein, PhD Director, Off-Target Biology Prime Medicine CONFIDENTI 1 AL
Slide 2: Summary
Summary Prime Editing precisely corrects a predominant mutation that causes Chronic Granulomatous Disease (CGD) Prime Editing restores protein expression and NADPH oxidase function in myeloid progeny produced from Prime Edited CGD patient CD34+ cells We have developed a comprehensive toolset to i
Slide 3: Prime Editing to correct pathogenic mutation in NCF1 that causes CGD
Strategy Prime Editing to correct pathogenic mutation in NCF1 that causes Chronic Granulomatous Disease (CGD) NADPH oxidase p47phox Chronic Granulomatous Disease • Description: • Rare disease causing recurrent, debilitating infections & premature death • Human genetics and biology: • Autosomal reces
Slide 4: Correction of ∆GT in NCF1 in CD34+ cells to restore p47phox expression
Strategy Correction of ∆GT in NCF1 in CD34+ cells to restore p47phox protein expression & function in myeloid progeny Correction of gene or pseudogene in CGD patient cells restores p47phox expression NCF1B NCF1 NCF1C Patient CD34+ cells ∆GT allele NCF1B NCF1 NCF1C Corrected allele + N N C C F F 1 1
Slide 5: Prime-Edited patient CD34+ cells generate myeloid cells that produce p47phox protein
Restored function in CGD Pt cells Prime-Edited patient CD34+ cells generate myeloid cells that produce p47phox protein and oxidase activity Myeloid progeny of Prime-Edited CD34+ cells from patient donor show functional p47phox expression Post-editing patient CD34+ p47phox expression2 restored PE res
Slide 6: CD34+ long-term hematopoietic stem cells self-renew & give rise to multiple cell lineages
Engraftment CD34+ long-term hematopoietic stem cells self-renew & give rise to multiple cell lineages to support lifelong blood production Given the heterogeneity within the CD34+ cell population, to evaluate human LT-HSC function, CD34+ cells are engrafted in immunodeficient mice until LT-HSCs repo
Slide 7: Successful Prime Editing long-term engrafted HSCs
Engraftment Successful Prime Editing long-term engrafted HSCs 16-week engraftment study with Donor 1 CD34+ cells Evaluate Infuse & evaluate Study Thaw CD34+ Deliver PE by Cryopreserve Prime Editing functionality of Schematic cells electroporation & thaw efficiency Prime Edited LT-HSC NBSGW mice in v
Slide 8: Safety: Prime editing and genotoxicity
Safety Safety: Prime editing and genotoxicity Prime Editing generates single On-target site strand breaks in DNA driven by Off-target sequence spacer interactions and uses reverse ? transcription (requiring two additional homology checks) to introduce a precise correction of a mutant sequence The
Slide 9: Safety: Prime's comprehensive suite of IND-ready assays for off-target discovery
Safety Safety: Prime’s comprehensive suite of IND-ready assays for off-target discovery* Local off-targets GGCCCAG-CTGAGCTCGTGA Chromosome scale or structural off-targets Off-target GGCCCAGACTGAGCACGTGA PE2 Translocations PE2 genome cDNA synthesis On-target Large Deletions Targeted Nick Genome wide
Slide 10: New tools developed to identify potential Prime Editor Off-targets
Safety New tools developed to identify potential Prime Editor Off-targets 3Prime End liGation Sequencing (PEG-seq) Prime Editing generates single strand breaks in DNA, most current off-target detection tools require double strand breaks. We are developing multiple single strand break specific tech
Slide 11: 3Prime End liGation Sequencing (PEG-seq) is a novel method for identifying potential off-targets
Safety 3Prime End liGation Sequencing (PEG-seq) is a novel method for identifying potential off-targets On-Target Signal Potential off-target sites identified for FANCF spacer Prime Editor SpCas9 H840A SpCas9 Potential Prime Editor off-target sites D10A overlap with sites identified using double str
Slide 12: General Evaluations of Safety of Prime Editing
Safety General Evaluations of Safety of Prime Editing Evaluation of potential off-target sites in Prime Edited or SpCas9 edited cells by deep sequencing Analysis of VEGFA Spacer Analysis of TTR Spacer 12 Spacers In silico and Percent Indels (off-target sites) 60 biochemical tools can % indels in ed
Slide 13: Safety evaluation of lead editors for our GSD1 and RHO Programs
Safety Safety evaluation of lead editors for our GSD1 and RHO Programs: preliminary off-target analyses do not identify off-target editing Evaluating off-targets in Prime Edited patient cells (G6PT) or Human Retinal explants (Rho) Editor Targeting Frameshift in G6PT Editor Targeting pathogenic SNP i
Slide 14: Safety evaluation of NCF1 editor for Prime's CGD program
Safety Safety evaluation of NCF1 editor for Prime’s CGD program: preliminary off- target analyses do not identify off-target editing using IND ready assays No off-target editing detected in long-term engrafted hematopoietic stem cells (LT-HSC) Indels Genome wide and targeted detection of potential o
Slide 15: Safety evaluation of NCF1 editor: No large deletions or translocations detected
Safety Safety evaluation of NCF1 editor: No large deletions or translocations detected in Prime Edited LT-HSCs* Digital PCR Large Deletion Assay One-sided PCR Chromosomal alterations assay No large deletions No large deletions or translocations in Translocation Positive Control: in pre-infusion CD34
Slide 16: Summary
Summary Prime Editing precisely and efficiently corrects a predominant mutation that causes Chronic Granulomatous Disease (CGD) Prime Edited HSCs maintain functionality in vivo (long-term engraftment, multilineage blood cell production, and biodistribution of blood cell progeny) We have developed
Slide 17: THANK YOU!
THANK YOU! CONFIDENTI 17 AL
Prime Medicine — Technical Presentation (October 2023) on 6ix