Sophia Genetics Sa · NASDAQ:SOPH
Sophia Genetics Sa — Investor Day (September 2022)
129 slides from Sophia Genetics Sa's investor day presentation, Sep 20, 2022
Slide 1: SOPHiA Investor Day
#S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y
Slide 2: Welcome
Welcome Jennifer Pottage, Head of Investor Relations Opening remarks Troy Cox, Chairman of the Board Building a data - driven world Dr. Jurgi Camblong, Chief Executive Officer Growing the SOPHiA network Ken Freedman, Chief Revenue Officer Capitalizing on our expanding biopharma opportunity Peter Cas
Slide 3: Cautionary Notices
Cautionary Notices #S OP H iNVES T O RD A Y This presentation contains statements that constitute forward - looking statements . All statements other than statements of historical facts contained in this presentation, including statements regarding our future results of operations and financial posi
Slide 4: Troy Cox, Chairman of the Board: Opening remarks
Troy Cox Chairman of the Board #S OP H iNVES T O RD A Y Opening remarks
Slide 5: A perspective shaped from 30+ years in the industry
A perspective shaped from 30+ years in the industry Sr. Vice President 2001 - 2006 Sr. Vice President 2010 - 2017 Chairman of the Board 2019+ 1990 - 2001 President 2006 - 2010 Chief Executive Officer 2017 - 2019 #S OP H iNVES T O RD A Y
Slide 6: #S
#S OP H iNVES T O RD A Y
Slide 7: Things you will hear frequently today
Things you will hear frequently today Better informed decisions Global network connectivity D ece nt rali z e d platform Uniquely qualified as an enabler #SOPHiNVESTORDAY
Slide 8: Video
Soy i NVESTORDAY VIDEO #SOPHINVESTORDAY
Slide 9: Building a data-driven world
Dr. Jurgi Camblong Chief Executive Officer & co - founder #SOPHiNVESTORDAY Building a data - driven world
Slide 10: sor i NVESTORDAY
sor i NVESTORDAY #SOPHINVESTORDAY
Slide 11: SOPH #SOPHiNVESTORDAY i NVEST
SOPH #SOPHiNVESTORDAY i NVESTO RD A Y
Slide 12: Meet SOPHiA GENETICS
July 23, 2021 #SOPHiNVESTORDAY SOPH i NVESTO RD A Y Meet SOPHiA GENETICS™ We are a category defining software company on a mission to Dem ocratize Dat a - Driven Medicine 500 SOPHiANS 750+ Connected Healthcare Institutions ~70 Countries lM+ Genomic Profiles Analyzed
Slide 13: Precision medicine opportunities
Precision medicine opportunities Building the future with machine learning and knowledge sharing #SOPHiNVESTORDAY
Slide 14: Our ambitious mission started in genomics
Our ambitious mission started in genomics #SOPHiNVESTORDAY
Slide 15: SOPHiA DDM Platform
SOPHiA DDM Platform #SOPHiNVESTORDAY our cloud - native software leverages the power of data analytics and predictive AI to transform the practice of healthcare
Slide 16: We are a first mover with critical mass
We are a first mover with critical mass #SOPHiNVESTORDAY
Slide 17: Patient journey of the future
Patient journey of the future #SOPHiNVESTORDAY
Slide 18: Patient journey of the future
Patient journey of the future #SOPHiNVESTORDAY
Slide 19: SOPHiA CarePath
SOPHiA CarePath #SOPHiNVESTORDAY
Slide 20: Predictive models will support data-driven medicine
Predictive models will support data - driven medicine vs. hypothesis - driven medicine #SOPHiNVESTORDAY
Slide 21: Generation #2 expanding sites
SOPH #SOPHiNVESTORDAY . i NVESTO RD A Y / II • 1, I I • From 2 3 s ite s !?u ! A • ' ' • • GENERATION # 2
Slide 22: Lung cancer expanding sites
S iNVESTORDAY for Lung cancer Expanding 7 50 + sit e s A GENERATION # 2 .. ,., ,,, .. ·· · ,, ·· OPH .. .. . . . · :·:.·. · ... . . . . . · . · · : . . . • . · ..... . . . . ·::: . ... .. . ........... . . . . . . . . . . . . . .. . . . . ... . ............. ··: :: .. , . .. . . ··:: ... . .........
Slide 23: Beyond lung
Beyond lung A Sites Lung cancer Breast cancer Brain cancer tut Kidney cancer r;J Colorectal cancer GENERATION # 2 I I .. ,,, .. · · I · I ·· iNVESTORDAY ·· ·· : . .. . · . . ·. : · . ..·... . . . . . : .. •· : - ··. ····.......... · ...... . • .... . •. ·· ···: .,• ··. . .. · ... .... ... . · ......
Slide 24: In the next phase
=m Inthe next phase ... we see the patients of today benefitting the patients of to
Slide 25: Extensive partner ecosystem
Extensive partner ecosystem joining forces to shape healthcare’s data - driven future #S OP H iNVES T O RD A Y
Slide 26: Raising the bar for collective intelligence
Raising the bar for collective intelligence A unified vision to create a new gold standard for cancer care #S OP H iNVES T O RD A Y
Slide 27: Massive market opportunity with room to grow
Massive market opportunity with room to grow Note: This slide presents our estimated addressable market for 2021. These estimates are primarily based on epidemiological data, including incidence and prevalence estimates of addressable populations for each application, as well as a range of price ass
Slide 28: Massive market opportunity with room to grow
Massive market opportunity with room to grow Note: This slide presents our estimated addressable market for 2021. These estimates are primarily based on epidemiological data, including incidence and prevalence estimates of addressable populations for each application, as well as a range of price ass
Slide 29: A biopharma partnership united in purpose
A biopharma partnership united in purpose Optimize, validate, and deploy ecDNA algorithms across technologies to improve patient selection and access #S OP H iNVES T O RD A Y
Slide 30: All SOPHiANS are KEY for our success
All SOPHiANS are KEY for our success our people and teams are agile, collaborative, and mission - driven #S OP H iNVES T O RD A Y
Slide 31: Today, we will answer THREE important questions
How we innovate How we sell How we grow sustainably 1 2 3 Today, we will answer THREE important questions #S OP H iNVES T O RD A Y
Slide 32: Growing the SOPHiA network
Ken Freedman Chief Revenue Officer #S OP H iNVES T O RD A Y Growing the SOPHiA network
Slide 33: Ken Freedman, Chief Revenue Officer
#S # O S P O H P iN H V iN E V S E T S O T R O D R A D Y AY Chief Revenue Officer Ken Freedman
Slide 34: Data in, answers out
Data in, answers out #S OP H iNVES T O RD A Y
Slide 35: Uniquely positioned to deliver customer value
Accelerate adoption of precision applications Expedite turnaround time Control costs Deliver top analytical performance Uniquely positioned to deliver customer value #S OP H iNVES T O RD A Y
Slide 36: Expansive global footprint
~ 1 10 N O RAM ~ 70 L A T A M ~ 80 A P AC ~ 490 E M EA 5 , 000+ potential customers as demonstrated by industry players #S OP H iNVES T O RD A Y 750+ c onn ec t ed h ea lth care ins t i t u tions today Expansive global footprint
Slide 37: Wide range of SOPHiA DDM applications
HRD HRS Trusight O n c olog y 500 My eloi d RNA Solutions Somatic O n c olog y Liquid Biop sy L ym pho ma Solid T u m o rs Co m p r ehen s i ve Genomic Profiling Onco - H e m a t o l og y Neurology BRC A H e r ed i t a ry Cancer Inherited & Rare Di s ea s e s M e t aboli sm Whole Exome Sequen c in g
Slide 38: 50% of customers currently use one SOPHiA DDM application
50% of customers currently use one SOPHiA DDM application 37% use two to three applications 13% use four or more applications Exciting opportunity exists to further expand within our existing customer portfolio 750+ connected healthcare institutions #S OP H iNVES T O RD A Y
Slide 39: A look into a customer's expansion journey
#S OP H iNVES T O RD A Y JAN 2019 $10K revenue 1 application 200 analyses END 2019 $250K revenue 9 applications 3,100 analyses END 2020 $400K revenue 8 applications 3,200 analyses END 2021 $790K revenue 11 applications 7,000 analyses PROJ 2022 $1.7M revenue 10 application
Slide 40: Highly effective land and expand engine
Highly effective land and expand engine #S OP H iNVES T O RD A Y Expand strategy • White space • Retention • Customer satisfaction ~100 C o mm e r c i a l team 20 customer success executives
Slide 41: Opportunity to land new customers
Opportunity to land new customers While we have landed 750+ customers … 5 , 000+ potential customers as demonstrated by industry players 750+ c onn ec t ed h ea lth care ins t i t u tions today #S OP H iNVES T O RD A Y
Slide 42: Opportunity to land new customers
Opportunity to land new customers While we have landed 750+ customers … 5,000+ potential customers as demonstrated by industry players 750+ c onn ec t ed h ea lth care ins t i t u tions today #S OP H iNVES T O RD A Y We have a massive opportunity to grow our reach
Slide 43: Highly effective land and expand engine: how we sell
~100 C o mm e r c i a l team 20 Global sales executives Highly effective land and expand engine How we sell Dir ec t Par t ners Distributors Land strategy #S OP H iNVES T O RD A Y • Targeting 5,000+ potential customers • Customers include hospitals, research institutions, and central labs • Focused
Slide 44: 66% of hits during an MLB season are singles
66% of hits during an MLB season are singles #S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y 12% of hits are homeruns
Slide 45: Our customers' sales journey
Our customers’ sales journey We are laser - focused on optimizing the KPIs throughout the journey Awareness KPIs: • # opportunities created Sales Process KPIs: • time in funnel • close rate Implementation KPIs: • time to revenue Loyalty KPIs: • net promoter score • customer health score #S OP H iNVE
Slide 46: Video
Soy i NVESTORDAY VIDEO #SOPHINVESTORDAY
Slide 47: Key takeaways
2 Proven land and expand strategy 3 Global team and structure in place 1 Large and growing market Key takeaways #S OP H iNVES T O RD A Y
Slide 48: Capitalizing on our expanding biopharma opportunity
Peter Casasanto Chief BioPharma Officer #S OP H iNVES T O RD A Y Capitalizing on our expanding biopharma opportunity
Slide 49: Peter Casasanto, Chief BioPharma Officer
Chief BioPharma Officer Peter Casasanto #S OP H iNVES T O RD A Y
Slide 50: BioPharma can leverage the power of data and analytics
BioPharma can leverage the power of data and analytics to more effectively deliver targeted therapies to the market #S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y
Slide 51: BioPharma is a well-established global industry but not without its challenges
#S OP H iNVES T O RD A Y 10+ years Average length from IND to approval ~80% Clinical trials fail to meet enrollment timelines ~10% Drugs make it from PI to approval ~$2B Average cost of drug de v e l op m en t BioPharma is a well - established global industry But not without its challenges Sources:
Slide 52: Our value proposition to BioPharma
Clinical Platform BioPharma Global clinical network Real - time computing Multimodal data Decentralized Scalable Improved decision making Enhanced comparative analysis Advanced patient finding These challenges require more than just data… Our value proposition to BioPharma is driven by SOPHIA GENETI
Slide 53: 3 pillars for growth: the three d's
D a ta Deployment Development Providing insights from multimodal datasets across decentralized network Leveraging AI and ML for the development of new solutions & predictive analytics Deploying proprietary and commercial solutions 3 pillars for growth: the three d’s #S OP H iNVES T O RD A Y
Slide 54: Our ability to deliver innovative biopharma solutions
Our ability to deliver innovative biopharma solutions A catalyst for SOPHiA GENETICS’ growth strategy… A B C Catalysts for growth Total addressable market in 2021 A Data Aggregating a growing number of data modalities with partnerships B Development Powering predictive multimodal algorithms through
Slide 55: Data: Putting our shared vision into practice
Data: Putting our shared vision into practice Accelerate longitudinal data sharing Generate standardized, clinically actionable insights Decentralize key solutions for testing tumors Collaborate to validate predictive algorithms #S OP H iNVES T O RD A Y
Slide 56: Development: A partnership powered by our decentralized platform
Platform co m pa t i b ili t y assessment Techn i cal f eas i b ili ty D eve l op m ent planning Optimization Verification IDE Submission • Oncogene amplifications frequently occur on ecDNA • Boundless Bio has built an ecDNA detection algorithm to identify patients with ecDNA driven cancers • Partne
Slide 57: Deployment: Expanding access to HRD testing globally
10+ Countries 30+ Institutions Offering laboratories innovative solutions to enable locally - delivered HRD testing Empowering lab customers to increase range of options for HRD detection Providing labs with full control of data to save time and cost Deployment: Expanding access to HRD testing globa
Slide 58: Building an invaluable multimodal data set
Improve multimodal data sets to support trial design and asset m anage m en t Expand the diversity and depth of clinico - genomic data cohorts Support translational and clinical trials for patient selection & stratification Accelerate collective intelligence through contributions of retro and prospe
Slide 59: Traction best evidenced by customer testimonials
We also learn from your approach, which we find as the only true holistic view SVP of Translational Medicine Top 10 biotech Your global footprint, universal approach and ability to deliver data through your tech platform is unique Immuno - Oncology Lead Top 20 pharma We see you as a data player … Yo
Slide 60: We are seeking to maximize the traction
1 2021 2022 Driven by multimodal deals and better targeting ~35 % Customer meetings 2 2021 2022 Higher demand across Data, Development and Deployment ~400 % Bookings projections 3 202 1 2022 Improved hit rate and larger deal sizes ~4 - 5X … and we are seeking to maximize the traction Number of pipel
Slide 61: Product market fit: just the tip of the iceberg
Product market fit Identify and nurture This is just the tip of the iceberg #S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y
Slide 62: Key takeaways
2 C oll a bo rat io n across 3 d’s 3 Positioned to be the multimodal partner of the future 1 Informed strategy and targeting Key takeaways #SOPH iNVESTORDAY
Slide 63: 15-minute Break
15 - minute Break #SOPH iNVESTORDAY
Slide 64: #S
#S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y
Slide 65: The importance of a global collective intelligence
Dr. Philippe Menu Chief Medical Officer #S OP H iNVES T O RD A Y The importance of a global collective intelligence
Slide 66: Dr. Philippe Menu, Chief Medical Officer
Chief Medical Officer Dr. Philippe Menu #S OP H iNVES T O RD A Y
Slide 67: Oncology has evolved from an organ-level view to molecular alterations
Oncology has evolved from an organ - level view to a focus on molecular alterations, fueled by genomics #S OP H iNVES T O RD A Y
Slide 68: Data-driven medicine is ushering a new era for cancer care
Data - driven medicine is ushering a new era for cancer care Fueled by increasingly targeted therapies, technology and advanced analytics #S OP H iNVES T O RD A Y
Slide 69: Cancer outcomes slowly improving, high unmet need remains
Cancer outcomes have been slowly improving over the past 50 years, yet high unmet medical need remains Average five - year survival rates from common cancer types in the United States, shown as the rate over the period 1970 - 1977 and over the period 2007 - 2013 . This five - year interval indicates
Slide 70: Today's reality: every cancer is different
Today’s reality: every cancer is different… Example: metastatic lung cancer is increasingly a collection of rare diseases #S OP H iNVES T O RD A Y
Slide 71: Oncologists face complex therapeutic decisions
… and oncologists face complex therapeutic decisions Current standard of care for non - oncogene addicted stage IV non - squamous NSCLC #S OP H iNVES T O RD A Y
Slide 72: Our SOPHiA DDM platform is part of the solution
Our SOPHiA DDM platform is part of the solution #S OP H iNVES T O RD A Y
Slide 73: Unlocking the power of multimodal digital health data sets
Unlocking the power of multimodal digital health data sets Predicting response to immunotherapy in first - line metastatic non - small cell lung cancer #S OP H iNVES T O RD A Y
Slide 74: The data we need is everywhere: lung cancer example
The data we need to enable individualized medicine is everywhere – lung cancer example #S OP H iNVES T O RD A Y
Slide 75: Multimodal approaches have the potential to transform medicine
Multimodal approaches have the potential to transform medicine – lung cancer example #S OP H iNVES T O RD A Y
Slide 76: A portfolio of multimodal applications will fuel SOPHiA CarePath
A portfolio of multimodal applications will fuel the SOPHiA CarePath module of our platform #S OP H iNVES T O RD A Y
Slide 77: SOPHiA CarePath enables multimodal longitudinal analysis
SOPHiA CarePath enables multimodal longitudinal analysis of health data #S OP H iNVES T O RD A Y
Slide 78: SOPHiA CarePath enables multimodal longitudinal analysis of health data
i SOPHIA CarePath enables multimodal longitudinal Sony iINVESTORDAY analysis of health data Data Visualization ill Longitudinal view across Placing the patient in the Predictive analytics modules the care journey and across context of other similar at an individual level data modalities patients acr
Slide 79: Key takeaways
2 Breaking data silos across instruments and institutions 3 Building a global multimodal collective intelligence 1 Vision of individualized data - driven medicine Key takeaways #S OP H iNVES T O RD A Y
Slide 80: Building the platform of the future
Dr. Zhenyu Xu Chief Scientific Officer #S OP H iNVES T O RD A Y Building the platform of the future Abhi Verma Chief Technology Officer
Slide 81: Abhi Verma and Dr. Zhenyu Xu
Abhi Verma Chief Technology Officer Dr. Zhenyu Xu Chief Scientific Officer #S OP H iNVES T O RD A Y
Slide 82: Our technology platform is the frame
Our technology platform is the frame… powered by our data science engine S afe Performant Pr ecise Innovative Leading Adaptable #S OP H iNVES T O RD A Y
Slide 83: The building blocks integrate to make a state-of-the-art platform
The building blocks integrate to make a state - of - the - art platform UNE T R Modular Architecture Knowledge Network Federated Data Querying CE - IVD, GDPR, HIPAA compliant Scalable & E xte n si b l e Embedded Data Protection Semantic T ec hno l og ie s Real - World, Real - Time Insights Cloud Bas
Slide 84: The platform breaks data silos and creates networks
100K 0K 200K 300K 400K 500K The SOPHiA DDM platform breaks data silos and creates networks Breaking data silos enables… Multimodal insights & a collective intelligence 19% of the flagged community insights in SOPHiA DDM are not classified in public databases #S OP H iNVES T O RD A Y 2015 2022 D ece
Slide 85: Rapid innovation and continuous improvement
We develop and operate with rapid innovation and continuous improvement To address the needs and requirements of a constantly evolving market and regulatory environment Enhanced Features & Analytical Functionalities 2 Week Release Cycles Highly A u t o m ate d Leading DevOps Practices C on ti nuou s
Slide 86: Customer centric approach remains the heart of our platform
Customer centric approach remains the heart of our platform Easy to Deploy • Click - and - go installation • Seamless integration across customer IT environments • Integrated with customer systems and workflows Easy to Use • Intuitive user interface • Independent of instruments and chemistries • Rap
Slide 87: We are in pole position
We are in pole position Disciplined execution of fundamentals keep us in the lead to Democratize Data - Driven Medicine Customer Centric Continuous Improvement S cala b ility Innovation #S OP H iNVES T O RD A Y
Slide 88: Leveraging decades of scientific expertise
Leveraging decades of scientific expertise 144 #S OP H iNVES T O RD A Y 188 225 238 237 202 228 252 157 100 28 ' 0 8 ' 0 9 ' 1 0 ' 1 1 ' 1 2 ' 1 3 ' 1 4 ' 1 5 ' 1 6 ' 1 7 ' 1 8 ' 1 9 ' 2 0 ' 2 1 ' 2 2 Citations by year 332 307 290 291 Total citations h - index i10 - index 3,241 17 18
Slide 89: Creating the data science engine of the future
Creating the data science engine of the future Machine Learning Deep Learning Innovative Precise & Accurate Adaptable #S OP H iNVES T O RD A Y
Slide 90: Our engine has been field tested
Our engine has been field tested Across hundreds of peer - reviewed applications in multiple fields g e n o m i c s radiomics m u l t i m o d a l 91 2020 61 2019 28 2018 133 2021 ~400 #S OP H iNVES T O RD A Y As of September 2022
Slide 91: Cancer is the most common human genetic disease
Cancer is the most common human genetic disease Many internal and external factors can trigger genetic change eventually leading to cancer Cell Division H ered i tar y E n vi ronmen t V i ru s GATGGGATTGGGGTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCT
Slide 92: Challenges in mutation identification
Challenges in mutation identification Combination of technical factors are the major sources of assay discordance Labs Sample Type Chemistry S e qu e n ce rs “Missed mutations (false negatives) were more common than erroneous candidates (false positives)…indicating that the reliable sampling of rare
Slide 93: Challenges in mutation identification: library prep
Challenges in mutation identification Diversity of library prep is needed to address different applications but causes workflow challenges Library Prep Qiagen Agilent IDT Twist P arago n Sequenc i n g Illumina Thermo Fisher MGI Mutation D e t ec t i o n Assay 1 Assay 2 B l ood / T i ssu e sample or
Slide 94: Challenges in mutation identification: sequencers
Challenges in mutation identification Different sequencers also generate variations in results Library Prep Qiagen Agilent IDT Twist P arago n Sequenc i n g Illumina Thermo Fisher MGI Mutation D e t ec t i o n B l ood / T i ssu e sample or DNA H i S e q N ext S e q #S OP H iNVES T O RD A Y
Slide 95: Solving the complexity of heterogenous workflows
Solving the complexity of heterogenous workflows There is a need for a platform that can harmonize the heterogeneity of workflows Lab Components, e.g. Polymerase Sequencing T e c hnologi e s Targeted Genes / Regions Enrichment Methods Deep Learning #S OP H iNVES T O RD A Y
Slide 96: SOPHiA DDM: Our Versatile Platform
Accurate SNP and INDEL Detection Secondary Analysis Superior CNV Resolution Secondary Analysis Advanced Variant Annotation Tertiary Analysis SOPHiA DDM – Our Versatile Platform Our innovative technologies help enable such harmonization Library Prep Disease Area Sequencer Application Lab 1 Q i age n
Slide 97: Leveraging our platform to inform PARP1 inhibition
Leveraging our platform to inform PARP1 inhibition HRD+ and eligible for PARP inhibitor treatment D oubl e - stra nd Break in DNA Homologous Recombination Repair Genes (BRCA1/2 etc) Cancer cell Normal cell A cc u m u l a t e d Damage D oub l e - s t r an d DNA Break Homologous R ec o m bin a tion De
Slide 98: SOPHiA DDM Dx HRD Solution
SOPHiA DDM Dx HRD Solution Creating a harmonized, highly accurate and precise technology ~1 year to develop and deploy #S OP H iNVES T O RD A Y
Slide 99: SOPHiA DDM Dx HRD Solution: concordance with reference method
SOPHiA DDM Dx HRD Solution Creating a harmonized, highly accurate and precise technology Excellent concordance with reference method Performance metric Value (95% CI interval) Overall percent agreement (OPA) 93.7% (91.0%, 95.6%) Negative percent agreement (NPA) 96.4% (93.1%, 98.2%) Positive percent
Slide 100: SOPHiA DDM Dx HRD Solution: consistency across workflows
SOPHiA DDM Dx HRD Solution Creating a harmonized, highly accurate and precise technology Excellent concordance with reference method Consistency across different genomic workflows Consistency across genomic workflows C ons i s t enc y across laboratories #S OP H iNVES T O RD A Y
Slide 101: SOPHiA DDM Dx HRD Solution: consistency across 9 laboratories
SOPHiA DDM Dx HRD Solution Creating a harmonized, highly accurate and precise technology Excellent concordance with reference method Consistency across 9 different laboratories Consistency across genomic workflows C ons i s t enc y across laboratories #S OP H iNVES T O RD A Y
Slide 102: Applying our technologies to other data modalities
Applying our technologies and expertise to other data modalities Leveraging our deep genomics expertise to harmonize radiomics 3D tumor segmentation Data standardization and pre - processing Radiomics features extraction (200+) CT – Lung Cancer MRI – Brain Cancer PET – Head and Neck Cancer #S OP H i
Slide 103: Unlocking the potential of multimodal health data
Unlocking the potential of multimodal health data Expanding our reach to other modalities will help further amplify our platform’s capabilities P r o te o m ic s Digital P at ho l og y Artificial intelligence / machine learning model R a d i o m ic s #S OP H iNVES T O RD A Y Technology and concepts
Slide 104: Key takeaways: We are the platform of the future
Potential to evolve & expand Unique algorithmic capabilities 2 3 1 Unmatched platform fundamentals Key takeaways We are the platform of the future #S OP H iNVES T O RD A Y
Slide 105: Delivering value creation via sustainable growth
Ross Muken Chief Financial Officer #S OP H iNVES T O RD A Y Delivering value creation via sustainable growth
Slide 106: Ross Muken, Chief Financial Officer
Chief Financial Officer Ross Muken #S OP H iNVES T O RD A Y
Slide 107: SOPHiA's platform strategy is resonating with customers
SOPHiA's platform strategy is resonating with customers #S OP H iNVES T O RD A Y FN 1: Represents statistic as of 06/30/2022. FN 2: Please refer to appendix for customer disclosure. FN 3: Please refer to appendix for recurring platform customer disclosure. FN 4: Represents statistic for DDM & Alamut
Slide 108: SOPHiA's platform strategy is resonating with customers
SOPHiA's platform strategy is resonating with customers #S OP H iNVES T O RD A Y FN 1: Represents statistic as of 06/30/2022. FN 2: Please refer to appendix for customer disclosure. FN 3: Please refer to appendix for recurring platform customer disclosure. FN 4: Represents statistic for DDM & Alamut
Slide 109: New logos, ARPU, NDR and LTV/CAC
30+ New Logos 1H 2022 New recurring platform customers • Evidence of success in the land portion of our growth strategy • Strong new customer growth – Showcases our ability to continue penetrating our large addressable market $91 K+ ARPU Average revenue per platform customer (1) • Evidence of succes
Slide 110: Focused initiatives to drive continued durable growth
Focused initiatives to drive continued durable growth 2. Driving sustainability Enhancing FTE productivity • Consistent focus on process improvement • Proper utilization of automation / systems • Key KPI: Revenue per FTE Gross margin efficiencies • Cloud compute / storage optimization effort • Lever
Slide 111: The path to $100M+ in revenue by 2025
The path to $100M+ in revenue by 2025 30% - 35% 2021 – 2025 constant currency growth p.a. ~500K Annual genomic profile analyses CarePath / MSK BioPharma acceleration U.S. Central Labs / HRD / MSK Clinical strength $40M +$100M 2 0 21 2 0 25 $100 M + $40M #S OP H iNVES T O RD A Y
Slide 112: Flywheel effect to boost biopharma contribution
Flywheel effect to boost biopharma contribution 10% - 20% of revenue base 100 %+ ~ 30 % Constant Currency CA G R 80% - 90% of revenue base 2 0 21 2 0 25 Clinical B io P h a r m a #S OP H iNVES T O RD A Y
Slide 113: Land and expand fuels efficient value creation
Land and expand fuels efficient value creation Scale initial solution A c h i e ve run rate Expand into new solution Scale new solution A c h i e ve run rate Land c u s t o m e r Phase 1: Landing Phase 2: Expanding Virtuous flywheel Consistently expanding value contributed by customer #S OP H iNVES
Slide 114: Customer consumption momentum builds over time
#S OP H iNVES T O RD A Y 22 9 23 22 246 46 20 15 49 252 Customer consumption momentum builds over time Our largest customers will continue to get even bigger Total Revenue Growth CAGR by Grouped Tier (1) $50K - $100K $100K - $150K Customer count by annual revenue contribution $150K - $200K $200 K+ 2
Slide 115: Sizable opportunity to cross/upsell our broad application set
Sizable opportunity to cross/upsell our broad application set Average number of solutions used #S OP H iNVES T O RD A Y Years on platform (by customer cohort) Recurring platform customers consistently add solutions as they spend more time on the platform 5 4 3 3 2 7 5 - 6 3 - 4 1 - 2 <1 50% of custo
Slide 116: GM expansion through efficiency and economies of scale
#S OP H iNVES T O RD A Y GM expansion through efficiency and economies of scale 64% 70%+ 2 0 21 2 0 25 500bps+ Adj. gross margin improvement Eco nomies of sc ale Labor e ff icie n cy Cloud cost leverage Note: Please refer to appendix for IFRS to adjusted gross margin reconciliation.
Slide 117: Operating leverage across the cost continuum
Operating leverage across the cost continuum Adj. Variable Costs Adj. Fixed Costs Wages & benefits FY2022 adj. operating expenses Go - forward trend • Limited headcount growth expected as future revenue can be supported by existing human capital base #S OP H iNVES T O RD A Y • Public company - relat
Slide 118: Positioning us on a path to breakeven
Positioning us on a path to breakeven R evenue Unit COGS Wages & Benefits Variable Costs Fixed Costs IFRS Adj. 2021 IFRS Adj. 2021 IFRS Adj. 2021 IFRS Adj. IFRS Adj. 2021 Op Profit / $ of Revenue 2021 $1. 0 0 #S OP H iNVES T O RD A Y ($0.38) ($0.36) ($1.33) ($1.33) ($0.71) ($0.50) ($0.35) ($0.33) ($
Slide 119: Positioning us on a path to breakeven
Positioning us on a path to breakeven $1. 0 0 #S OP H iNVES T O RD A Y ($0.38) ($0.36) ($0.30) ($1.33) ($1.33) ($0.40) ($0.71) ($0.50) ($0.23) ($0.35) ($0.33) ($0.08) ($1.77) ($1.52) - IFRS Adj. Illus. Fu t u r e 2021 COGS R evenue Unit IFRS Adj. Illus. Fu t u r e 2021 Wages & Benefits IFRS Adj. Ill
Slide 120: Ample capital to execute on key initiatives
$217M Q2 2022 2 0 25 Ample capital to execute on key initiatives Long - term sustainability Visible path to profitability and cash flow generation #S OP H iNVES T O RD A Y 2023 2024 Cash, cash equivalents, & term deposits
Slide 121: Though we have been successful, this is only the beginning
Transformative product launches Enhanced customer journey BioPharma traction Leading partnerships Gross margin improvements Sustained operating leverage Optimized product and commercial investments Ample cash runway and path to profitability Though we have been successful… this is only the beginning
Slide 122: Today, we answered THREE important questions
How we innovate How we sell How we grow sustainably 1 2 3 Today, we answered THREE important questions #S OP H iNVES T O RD A Y
Slide 123: Democratizing Data-Driven Medicine
Democratizing Data - Driven Medicine T : - :. r, E T 1 - 1 I= D
Slide 124: Q&A
Q&A LEARN MORE ABOUT SOPHiA GENETICS sophiagenetics.com linkedin.com/company/sophiagenetics #S OP H iNVES T O RD A Y @sophiagenetics
Slide 125: #S
#S OP H iNVES T O RD A Y #S OP H iNVES T O RD A Y
Slide 126: Appendix: Disclosures
A p p e ndi x #S OP H iNVES T O RD A Y Customer Disclosure: Represents active customers who have generated revenue through DDM platform usage or Alamut licenses in the trailing 12 - month period as of June 30, 2022. Recurring Platform Customer Disclosure: Defined as the number of customers who acces
Slide 127: Reconciliation of IFRS to adjusted gross profit for 1H 2022
#S OP H iNVES T O RD A Y Reconciliation of IFRS to adjusted gross profit and gross profit margin for 1H 2022 Amounts in USD thousands (unaudited) Six months ended June 30, 2022 Revenue $22 , 528 Cost of revenue (8,197) Gross profit $14 , 331 Amortization of capitalized research and development expen
Slide 128: Reconciliation of IFRS to adjusted operating profit for FY 2021
#S OP H iNVES T O RD A Y Reconciliation of IFRS to adjusted operating profit for FY 2021 Revenue $40 , 450 $40 , 450 Cost of Revenue ( 15 , 229 ) 483 88 ( 14 , 658 ) Gross Profit $25 , 221 $483 $88 $25 , 792 Wages & Benefits ( 53 , 739 ) ( 53 , 739 ) Variable Expenses ( 28 , 759 ) 8 , 51 4 ( 20 , 24
Slide 129: Notes to the reconciliation of IFRS to adjusted financial measures
Notes to the reconciliation of IFRS to adjusted financial measures tables (1) Amortization of capitalized research and development expenses consists of software development costs amortized using the straight - line method over an estimated life of five years. These expenses do not have a cash impact