Coya Therapeutics, Inc. · NASDAQ:COYA
Coya Therapeutics — 5th Exosome Based Therapeutics Summit (November 2023)
25 slides from Coya Therapeutics's conference presentation, Nov 8, 2023
Slide 1: Rapid Functionalization of Treg Exosomes for Targeted Immunotherapeutics
Rapid Functionalization of Treg Exosomes for Targeted Immunotherapeutics Phil Campbell, PhD Carnegie Mellon University on behalf of Coya Therapeutics, Inc. 5th Exosome Based Therapeutics Summit Boston, MA 7 September 2023
Slide 2: Therapeutic Potential of Exosomes
Therapeutic Potential of Exosomes Immunoregulation Regenerative Medicine Transplantation Angiogenesis The potential innate therapeutic properties of MSC, Treg and Platelet exosomes mirror those of source cells themselves. Thus, these exosomes have the potential to simplify therapy logistics while pr
Slide 3: Just Like the Mythological Janus, MSC-Exosomes and Treg Exosomes have Two Sides
Just Like the Mythological Janus, MSC-Exosomes and Treg Exosomes have Two Sides- - They can be Drivers of immunoregulation promoting tissue regeneration and transplant immunotolerance. - They can be Drivers for the promotion of cancer development.
Slide 4: Tregs are Important Immunomodulatory Cells and are Drivers Controlling Inflammation
Tregs are Important Immunomodulatory Cells and are Drivers Controlling Inflammation, Enabling Tolerance, Promoting Healing and Regenerative Processes, but…… Inflammatory Tregs immune cells Autoimmunity Healthy Cancer Reduction and loss of Treg population Balanced Treg and inflammatory Abnormal incre
Slide 5: Treg Exosomes Suppress Pro-Inflammatory Myeloid Cells and T Cell Proliferation
Treg Exosomes Suppress Pro-Inflammatory Myeloid Cells and T Cell Proliferation Thome 2022 Front Immunol 13:875825
Slide 6: Treg Exosomes Can Have "Better" Immunomodulation to MSC Exosomes
Treg Exosomes Can Have ”Better” Immunomodulation to MSC Exosomes However, the primary cavate is that these cells are primary so hugely heterologous both within and across isolates. Thome 2022 Front Immunol 13:875825
Slide 7: Precision Cut Tissue Slices as a Model to Study Treg Exosome Function
Precision Cut Tissue Slices as a Model to Study Treg Exosome Function EV Against Ischemic Injury EV Against Inflammation
Slide 8: Examples of Treg EV Protection of PCTS From Either Hypoxia or Inflammation
Examples of Treg EV Protection of PCTS From Either Hypoxia or Inflammation
Slide 9: Exosomes are Nature's Nanoparticle Drug Delivery Vehicle
Beyond the Inherent Cargo Properties, Primary MSCs iP Exosomes are Nature’s Nanoparticle M SC Drug Delivery Vehicle SC s Inherent Cargo s - Designed for receiver cell uptake. Properties - Crosses physiological barriers that - Immunoregulatory Treg the “typical” man-made nanoparticle Cell - Angiogeni
Slide 10: Engineering Exosome Cargo Presents Opportunities to Improve Their Therapeutic Potential
Engineering Exosome Cargo Presents Opportunities to Improve Their therapeutic Potential - Improving stability - Increasing plasma retention during systemic delivery - Altering biodistribution Beyond their innate cargo, there are opportunities to - Increasing residence time during local provide addit
Slide 11: We at CMU are Developing Non-Genetic Engineering and Direct Approaches to Load Exosome Cargo
We at CMU are Developing Non-Genetic Engineering and Direct Approaches to Load Both Luminal and Surface Exosome Cargo Engineering Exosome Luminal Cargo Engineering the Exosome Surface Cholesterol-DNA Yerneni et al. 2021 J Tethers Extracell Vesicles 10:e12155 S. S. Yerneni*, S. Lathwal* et. al., ACS
Slide 12: Generalized and Direct Exosome Surface Functionalization Using DNA Tethers
Generalized and Direct Exosome Surface Functionalization Using DNA Tethers Sai Yerneni Sushil Lathwal Krzysztof Matyjaszewski Subda Das Julia Cuthbert -Independent of cell source -Control over surface loading -Multivalent functionalization -2000-8000 DNA tethers/EV -Scalable -Stable tethering at 4C
Slide 13: Dose Dependency of ssDNA Tethers and Stability on Exosomes
Dose Dependency of ssDNA Tethers Stability of ssDNA Tethers on Exosomes S. S. Yerneni*, S. Lathwal* et. al., ACS Nano (2019)
Slide 14: Cell Uptake of DNA-Tethered Exosomes
Cell Uptake of DNA-Tethered Exosomes S. S. Yerneni*, S. Lathwal* et. al., ACS Nano (2019)
Slide 15: Exosomes Functionalized With FasL (Exo-FasL) are Bioactive In Vitro
Exosomes Functionalized With FasL (Exo-FasL) are Bioactive In Vitro FasL induces apoptosis in Fas receptor-bearing cells Exo-FasL induce potent apoptosis in Jurkat cells Exosome Fas Exo-FasL Receptor Jurkat cells S. S. Yerneni*, S. Lathwal* et. al., ACS Nano (2019)
Slide 16: Exosomes Functionalized with FasL-Strep Alter the Immune Microenvironment of the Spleen and Lymph Node
Exosomes Functionalized with FasL-Strep to EVs via DNA Sai Yerneni Suba Das Tethers Alters the Immune Microenvironment of the Spleen Haval Shirwan Esma Yolcu and Lymph Node Pradeep Shrestha S. S. Yerneni*, S. Lathwal* et. al., ACS Nano (2019)
Slide 17: Could we engineer the surface of the Treg exosome to improve delivery to immune cells?
We asked the question, could we engineer the surface of the Treg exosome to improve their delivery to immune cells? We considered increasing the EV surface of CTLA4 using our DNA-cholesterol tethering approach. We created tethers with terminal aptamers to either His or Fc tagged recombinant proteins
Slide 18: CTL4 is contained in/on Treg Exosomes
CTL4 is contained in/on Treg Exosomes Thome 2022 Front Immunol 13:875825
Slide 19: Aptamer Sequences with chol-DNA Tethers for Direct Engineering of CTLA4 onto Treg Exosomes
Aptamer Sequences with chol-DNA Tethers for Direct Engineering of CTLA4 onto Treg Exosomes DNA'-3T-ApFc AGCTATGGGATCCAACTGCAGTTTTGCCACATTAGTCTCACCACTACCTGCGTACCTACCGCCGC Chol-DNA-aptamer DNA'-3T-ApHis AGCTATGGGATCCAACTGCAGTTTTGTTTGCCGGTGGGCAGGTTTAGGGTCTGCTCGGGATTGCGGAGGAACA TGCGTCGCAAAC DNA'-3T-ApNC
Slide 20: Chol-DNA Tethers can be Loaded onto Treg EVs
Chol-DNA Tethers can be Loaded onto Treg EVs
Slide 21: CTLA4 can be Tethered to Treg Exosomes Using Aptamers on chol-ssDNA Tethers
CTLA4 can be Tethered to Treg Exosomes Using Aptamers Sequences on the chol-ssDNA Tethers
Slide 22: CTLA4 Increases Uptake of Treg Exosomes into Macrophages
CTLA4 Increases Uptake of Treg Exosomes into Macrophages
Slide 23: CTLA4 Increases Uptake of Treg Exosomes into T Cells
CTLA4 Increases Uptake of Treg Exosomes into T Cells.
Slide 24: Rationale for Engineering CTLA4 onto Treg Exosomes to Increase Targeting to Immune Cells
Rationale for Engineering CTLA4 onto Treg Exosomes to Increase Targeting to Immune Cells.
Slide 25: Summary
Summary - Engineering exogenous CTLA4 onto Treg exosomes results in their increased binding and internalization into immune cells. - Therefore, the delivery of the Treg exosome cargo (both surface and luminal) to modify both innate and adaptive immune cells is expected to be enhanced. We will be det
Coya Therapeutics — 5th Exosome Based Therapeutics Summit (November 2023) on 6ix